Кирилл и александра совместимость: 404 — HTTP not found —

Кирилл и александра совместимость: 404 — HTTP not found —

Содержание

Совместимость Александры и Кирилла | ГОРОСКОПЫ 365

80%1. по Характеру

1+42. по Нумерологии

Солнце   Уран

АК3. по Буквам

Тип отношений:«Союз царственных особ»

Маловероятно, что этот союз вообще состоится, но если он все-таки состоялся, то обоим придется научиться уступать, иначе их отношения рассыплются как карточный домик. Дело в том, что Александра и Кирилл обладают очень волевым, сильным характером, так что даже несмотря на взаимное влечение, им, как правило, бывает очень нелегко ужиться под одной крышей.

В быту это нередко выливается в борьбу за лидерство в семье, споры и конфликты. Впрочем, если они научатся сдерживать свои амбиции, их отношения могут продлиться очень долго. В этом случае Александра способна стать не только прекрасной женой и хозяйкой, но и лучшим другом своего избранника и даже помогать ему в работе.

Совет для Александры

Совет для Кирилла

Секреты общения с Александрой

Иногда бывает непросто за внешней холодностью или некоторой бесшабашностью Саши разглядеть ее тонкую душу, тем не менее, если вам это удастся, значит, вы найдете ключ к ее душе или даже сердцу.

Нелишне обратить внимание на то, как она предпочитает себя называть. Уравновешенные женщины обычно представляются как Саша, если в характере преобладает властность – Александра, когда же она хочет скрыть свою женственность и довольно ранимую душу, тогда Александра может представиться просто Шурочкой.

Секреты общения с Кириллом

Обычно Кирилл ценит свою самостоятельность, но нередко люди, соблазнившись его видимой уравновешенностью, пытаются активно воздействовать на него и незаметно наживают себе врага. Бывает и так, что кто-то невольно становится источником раздражения для Кирилла. Вряд ли дело дойдет до скандала, тем не менее человек проницательный сможет заметить растущее напряжение в его душе. В этом случае разрядить обстановку можно, переключив разговор на ту тему, где Кирилл чувствует себя профессионалом. Если вы сумеете разглядеть его достоинства в этой области, то, скорее всего, вместо раздражения между вами появится взаимное уважение.

Все тайны Александры

начало статьи

Безусловно, в первую очередь энергетику имени Александра определяет то, что оно все-таки более мужское, чем женское. Конечно, это не означает, что Александра будет выглядеть этаким мужиком в юбке, здесь точно так же, как и в женском костюме, когда одежда мужского покроя может подчеркнуть женственность девушки, а может и "омужичить" ее. Все зависит от того, как этот костюм носить.

Полная характеристика имени >

Все тайны Кирилла

начало статьи

Напряженность этого имени не сразу заметишь. По энергетике в нем ощущается значительная сила и твердость, быть может, даже излишняя. В то же время оно звучит довольно замкнуто, мало склоняя своего владельца к внешнему проявлению силы. Обычно имя наделяет Кирилла умеренным спокойствием и жизнерадостностью, однако с возникновением каких-либо проблем в его душе начинает нарастать напряжение, особенно заметное в подростковом периоде, когда оно нередко делает Кирилла чересчур раздражительным. Да и в более зрелые годы за его видимой уравновешенностью можно иногда разглядеть готовность моментально ощетиниться и постоять за себя.

Еще о характере Кирилла >

1. по Характеру2. по Нумерологии3. по Буквам

Александра
1
число имени
Солнце
планента имени

Кирилл
4
число имени
Уран
планента имени

Александра: расчет числа и планеты имени

Числовое соотвествие букв имени: А - 1, Л - 4, Е - 6, К - 3, С - 1, А - 1, Н - 6, Д - 5, Р - 9, А - 1

Расчет числа имени: 1 + 4 + 6 + 3 + 1 + 1 + 6 + 5 + 9 + 1 = 37 = 3 + 7 = 10 = 1 + 0 = 1

Числу 1 в нумерологии соответствует планета Солнце

Кирилл: расчет числа и планеты имени

Числовое соотвествие букв имени: К - 3, И - 1, Р - 9, И - 1, Л - 4, Л - 4

Расчет числа имени: 3 + 1 + 9 + 1 + 4 + 4 = 22 = 2 + 2 = 4

Числу 4 в нумерологии соответствует планета Уран

Александра и Кирилл: совместимость по нумерологии 1 + 4 (Солнце + Уран)

В начале отношений Единица честно пытается объяснить возлюбленному, что напряженная работа - не единственный способ обеспечить себе и своей любимой достойное существование. Но трудоголик- Четверка не согласен: он готов поверить в личную харизму, но считает, что обделен ею при рождении. Они понимают стремления друг друга и разделяет их. Вот только методы достижения цели у них разные.

Единице нравятся успешные, состоявшиеся личности, но с Четверкой ей приходится нелегко. Она не может смириться с тем, что избранник постоянно оценивает ее поступки, подвергает оценке суждения, не доверяет интуиции. Ее угнетают перепады в настроении Четверки, с ним ей не хватает азарта, веселья, праздничного настроения.

Плюсами таких отношений станут стабильность (она всегда появляется там, где уже есть Четверка), и взаимопонимание, поскольку настоящая женщина подберет ключ к душе партнера и начнет тихо им руководить. Интимная жизнь покажется представительнице прекрасного пола немного скучной, но мужчина найдет способ компенсировать свои недостатки.

1. по Характеру2. по Нумерологии3. по Буквам

аЛеКсандРа
КиРиЛл

Дополнительным тестом на совместимость имен считается самый простой: надо посмотреть, сколько именно букв (и каких) в именах мужчины и женщины совпадают. Общие буквы имен указывают на их общие увлечения, черты характера, хобби. Это дополнительный потенциал, который пара может реализовать.

Совместимость по буквам имен Александра и Кирилл

В именах Александра и Кирилл совпадают 3 буквы из 6 возможных (буквы Л, К, Р). Это свидетельствует о том, что партнеры при желании смогут найти достаточно много общего – это могут быть общие хобби, увлечения, досуг. А любые общие интересы крепко связывают влюбленных между собой, повышая их совместимость!

Согласно буквенной совместимости имен, у Александры и Кирилла общие интересы могут быть основаны на:

  • На интересах, связанных с музыкой, пением или ораторским искусством, а также с общением с людьми: чем больше общения – тем лучше!
  • На совместных задачах, приносящих конкретную пользу – себе или окружающим. Это могут быть благотворительные проекты (совместное волонтерство), ремонт квартиры своими руками, здоровый образ жизни.
  • На совместных увлечениях, которые требуют решительных действий, – например, занятиях фитнесом, вождением или экстремальными видами спорта.

Кирилл Совместимость с Женскими Именами

Кирилл – греческое имя, означающее «господин». Кирилл обладает высокой самооценкой и самолюбием, которое довольно просто ущемить. В детстве ему нравится производить хорошее впечатление на взрослых, быть примером для других детей. Он не любит шумных игр и проказ, предпочитая более спокойные занятия. Друзей у Кирилла немного, так как он слишком критично относится к окружающим и не умеет им доверять. Он нередко пробует свои силы в творчестве, причем весьма успешно. Также у Кирилла есть лидерские качества, которые помогают ему добиваться профессиональных высот. Однако серьезным препятствием на пути к успеху может стать недостаток умения общаться с людьми, располагать их к себе. Кириллу следует выработать в себе такие качества, как тактичность и деликатность.

Совместимость имени Кирилл в любви

Кирилла нельзя назвать особо удачливым в любви. Он – не романтик, наоборот, его взгляд на отношения весьма практичен. Кирилл предъявляет к окружающим, в том числе, и к своей возлюбленной, завышенные требования. Ему трудно простить свою избранницу, даже если он сам совершает подобные проступки. Кирилл неспособен просто и легко выражать свои чувства, делать комплименты, совершать романтические поступки. Он часто критикует свою возлюбленную, порой излишне резко. Ему кажется, что, таким образом, их отношения станут более честными и прочными, но не всем женщинам нравится подобный подход.

Женится Кирилл довольно поздно и не всегда по любви. Его пугает одиночество, отсутствие рядом хотя бы кого-то. К сожалению, подобный брак редко бывает удачным. Кирилл может притворяться, поначалу, что доволен своей жизнью, но потом этому наступает конец. Развод он переживает тяжело, хотя старается этого не показывать. Ведение хозяйства Кирилл доверяет супруге, хотя с удовольствием поможет ей, если та попросит мужа о помощи. Как отец, Кирилл довольно строгий и даже деспотичный, что не способствует теплым отношениям между ним и его детьми.

Кирилл Совместимость с Женскими Именами

Наибольшая вероятность прочных отношений у Кирилла с именами: Акулина, Александра, Алена, Алиса, Анжела, Ариадна, Варвара, Вита, Владислава, Елена, Инесса, Калерия, Лидия, Мария, Нелли, Олеся, Прасковья, Рената, Стелла, Снежана, Татьяна, Юлия.

Наименьшая вероятность прочных отношений у Кирилла с именами

: Агния, Аза, Алла, Альфия, Валерия, Джульетта, Диана, Доминика, Евгения, Елизавета, Жанна, Инга, Кристина, Любовь, Майя, Марианна, Марта, Марфа, Мирослава, Наталья, Нина, Ольга, Пелагея, Полина, Регина, Римма, Серафима, София, Тамара, Фаина, Ульяна, Чулпан, Элеонора.

Значение Имен

Гороскоп на Сегодня

Какое имя подходит юлии для брака. Юлия – совместимость в любви и браке с мужскими именами


Каждое имя наполнено определенными вибрациями, которые определяют то, как сложится судьба человека. Астрологи и эзотерики выделяют хорошо совместимые и несовместимые имена. Определяется это посредством сопоставления характеров людей, которые формируется под влиянием имен.

Эта статья расскажет о совместимости имен Александр и Юлия. Далее в статье можно будет найти ответы на следующие вопросы: как будут складываться отношения Саши и Юли в любви, дружбе и профессиональной деятельности, а также, насколько хорошо эти люди подходят друг другу для заключения брака.

Совместимость имён Юлия и Александр в любви и браке

Нумерологическое число имени Александр (А + л + е + к + с + а + н + д + р) — 9, число имени Юлия (Ю + л + и + я) — 7.

Юлия умеет подать себя с лучшей стороны. Прекрасно знает, чем можно привлечь поклонников, хотя нельзя сказать, будто ей нужно чрезмерное внимание.

Семёрка-Юлия стремится связать жизнь с состоявшимся мужчиной, достигнувшим определённого статуса и положения в обществе. Она ищет опору, но желает сохранить личную независимость. Решив, что кандидат на её сердце соответствует требованиям, старается узаконить отношения.

Семёрка-Юлия ценит стабильный предсказуемый союз. Больше всего Юлия опасается разрыва. Не желая причинять себе боль, способна долго терпеть бесперспективную связь, в глубине души надеясь, что всё изменится к лучшему.

Семёрка-Юлия не всегда способна правильно оценить намерения партнёра. Склонна идеализировать избранника, что приводит к разочарованиям в дальнейшем.

Она хочет быть желанной, хочет ощущать заботу со стороны возлюбленного. Вместе с тем, в союзе часто занимает главную роль.

Девятка-Александр ищет женщину, с которой его свяжет не столько физическая, сколько духовная близость. Будучи человеком открытым и утончённым, он находится в поиске родственной души, способной принять и понять его порывы.

Мужчина-девятка романтичен, он с пренебрежением относится к материальным ценностям, что, впрочем, не означает, будто у него низкий уровень дохода. Александр часто витает в облаках, предаваясь мечтам. Избранница Александра кажется ему идеальным созданием.

Он любит путешествия, отправляется в них при первой возможности. Сам того не желая, Александр-девятка заводит дорожные романы, которые могут длиться достаточно долго.

Александр умён, с ним интересно спорить, хотя Александр не часто принимает точку зрения, отличную от его мнения. Ценит свободу, из-за чего не может решиться на создание серьёзных отношений. Мужчина-девятка бывает несдержанным, хотя старается контролировать свои чувства. Чуткий и восприимчивый к проблемам избранницы.

Союз Юлии и Александра часто оказывается удачным. Для семёрки-Юлии и девятки-Александра главной является духовная составляющая, тогда как материальные вопросы их интересуют мало. Проблемы у пары обычно возникают на бытовом уровне, ведь Юлия и Александр слабо приспособлены для решения насущных дел.

Ученым-историкам неизвестно точное происхождение имени Юлия, но существует версия, что оно является производным от имени Юла Аскания — основателя города Альба-Лонга. Считается, что знаменитый Юлий Цезарь был прямым потомком Юла Аскания. В древнем Риме Имя Юлия стали давать женщинам из рода Юлиев.

Юлия — одно из самых светлых, простых и красивых православных женских имен, популярность которого с годами не только не утратилась, но и продолжает расти. И это неудивительно, ведь столько прекрасных и талантливых женщин носят имя Юлия. Например, певицы Юлия Началова и Юлия Савичева, актрисы Юлия Меньшова и Юлия Снигирь, писательницы Юлия Шестакова и Юлия Вознесенская, фигуристка Юлия Липницкая, режиссер Юлия Краснова и многие другие.

Как выстроить отношения

Рассмотрев совместимость имен Александр и Юлия, предлагаем познакомиться с некоторыми советами специалистов о том, как этим людям создать гармонию в отношениях. Мужчине рекомендуется постараться стать более романтичным, дарить своей избраннице подарки, проявлять фантазию, делать сюрпризы. Юлия любит комфорт и материальное благополучие, поэтому нужно очень постараться это ей обеспечить.


Смотреть галерею

Женщина должна попытаться стать мягче и уступчивее, дать избраннику возможность проявить себя, стать для нее рыцарем. Конечно, Юлия стремится к самостоятельности, готова работать днями и ночами, чтобы обеспечить себя всем необходимым. Это сильная натура. Но для сохранения семьи иногда ей стоит притвориться слабой. В этом случае отношения укрепятся, между партнерами воцарятся гармония и взаимопонимание.

В целом пара может стать счастливой, самое главное – хотя бы немного уступать своей второй половине.

Именины и святые покровители

Главной покровительницей всех женщин по имени Юлия считается Юлия (Иулия) Карфагенская, жившая примерно в 200-400 годах до нашей эры. В возрасте 10 лет Юлию из Карфагена продали в рабство в Сирию, где она попала в языческую семью. Хозяин неплохо к ней относился, но не мог переубедить девушку принять языческую веру — она по-прежнему оставалась верной христианкой.

В возрасте 20 лет разбойники Юлию выкрали у ее доброго хозяина, и хотели силой принудить ее принять язычество. Разбойники долго пытали и издевались над девушкой, но она не сдавалась, и тогда язычники распяли ее на кресте. Перед смертью из распятой Юлии вылетел ангел, при воде которого разбойники испугались и разбежались. Тело Юлии сняли с креста и похоронили в ближайшем христианском монастыре.

В православных святцах есть еще несколько святых по имени Юлия, поэтому именины можно выбирать ближе к своему дню рождения из следующих дат: 3, 9 и 15 января. 17 марта, 2 апреля, 16 и 31 мая, 15 июня, 5, 19 и 29 июля, 30 и 31 августа, 14 ноября, 10 и 17 декабря.

Число имени Таня 6

Символизирует развитое чувство прекрасного, предприимчивость, доброту, отзывчивость. Люди Венеры излучают чувственность, все они увлечённые и увлекающиеся натуры, всем им чрезвычайно важно любить и быть любимыми. Впрочем, их неподражаемое очарование и открытость позволяют им обходить все подводные камни в жизни. С успехом работают в тех сферах, где приходиться общаться с людьми. Природные задатки позволяют им становиться политическими деятелями или высокопоставленными государственными чиновниками, но при условии, что их слово не расходится с делом. Они быстро усваивают ту истину, что честность плодотворнее честолюбия, что благородные поступки помогают достигать цели надежнее, чем радикальные методы. Они должны быть внимательны в обращении с деньгами, иначе рискуют понести большие потери. К счастью, они редко испытывают финансовые затруднения. Внешне это очень привлекательные, живые и непосредственные люди. Иногда им свойственно некоторое высокомерие и излишняя забота о своей внешности.

На то, как сложатся отношения между двумя людьми, влияет множество факторов, главным из которых является личность человека. На формирование личности влияет воспитание, общество и имя, которым нарекли при рождении.

У Александра и Татьяны совместимость очень благоприятная. Они близки друг другу по духу. Их союз в любви, дружбе и на работе станет успешным, если они будут руководствоваться искренними чувствами и честными намерениями.

Характеристика

Юлия — коммуникабельная и непосредственная личность, которую трудно не заметить. Энергетике имени свойственны такие черты как капризность, эгоистичность, упрямство и умение добиваться желаемого любыми путями.

Юлия — это всегда талантливый и неординарный человек, она просто не может быть глупой и посредственной. Она общительна и открыта, но за внешней жизнерадостностью всегда кроется личный корыстный интерес. Она не станет помогать ближнему своему только потому, что он в этом нуждается. Юлия никогда и ничего не делает даром. Но в то же время она имеет склонность к авантюрам, неоправданному риску и поспешным решениям.

Круг знакомых Юлии состоит из успешных и обеспеченных людей, это должны быть сливки общества, в котором она вращается. Она неизменно тактична и корректна со всеми, такого же отношения требует и к себе — менторский тон или давление по отношению к ней нежелательны и неэффективны.

К любому делу в своей жизни Юлия подходит ответственно — будь то карьера, выбор места работы или замужество. Она совершенно не страдает предрассудками, но по отношению к себе немного мнительная. Нравоучений в свой адрес не потерпит, но и свое мнение никому навязывать не станет.

Всем Юлиям присуще чувство собственного достоинства и даже гордость. Женщина всегда выполняет взятые на себя обязательства, ее слова редко расходятся с делом. У нее твердый и честный характер, хотя многие принимают эти черты за упрямство.

Юлия прекрасно умеет сдерживать свои эмоции, поэтому со стороны может казаться холодной и равнодушной. В душе она сентиментальна и ранима, но умеет хорошо скрывать свои чувства. Юля старается избегать ситуаций, в которых ее чувства могут вырваться наружу.

Юлия невероятно изворотливая натура, умеющая выйти «сухой из воды» при любых обстоятельствах. Великолепное чувство юмора, острый ум, находчивость и наблюдательность делают ее незаурядной личностью, которую невозможно не заметить.

Общая информация

Обладатели этих популярных имен – яркие независимые личности, целеустремленные и сильные. Александр готов работать от заката до рассвета, чтобы обеспечить семью или свою избранницу всем необходимым. Он готов уступать в мелочах, но важные решения предпочитает принимать самостоятельно. Это умный человек, любящий учиться, обладающий широким кругом интересов.

Юлия – веселая, общительная и целеустремленная девушка, которая умудряется успевать все – и посидеть в кафе с подругами, и поработать на славу, и получить несколько образований. Обе личности активные, вместе им будет интересно, но однако совместимость имен Александр и Юлия сложно назвать идеальной. Это два лидера, для которых важно собственное мнение и возможность поступить по-своему. Обоим трудно идти на компромиссы, оба стремятся к роли главы семьи.


Смотреть галерею

Детство

Маленькая Юля — увлекающаяся и эмоциональная девочка, которая умеет заражать своей радостью всех окружающих. Она любит находиться в центре внимания, чувство стеснения ей несвойственно. В детстве ребенку часто бывает тяжело ладить с самыми близкими для нее людьми — родителями.

Девочка упряма, будет стоять на своем, даже если будет чувствовать, что не права. У Юли богатая фантазия, она очень близко и эмоционально воспринимает услышанное и увиденное, часто обижается. В подростковом возрасте девушка становится замкнутой и молчаливой — эти качества, скорее всего, будут сопровождать ее по жизни.

Из ребенка может вырасти отличная спортсменка или танцовщица, поэтому очень важно как можно раньше отдать ее в спортивную или танцевальную секцию.

Юля хорошо учится в школе, так как умна и очень много читает. Она всячески избегает ссор и конфликтов с одноклассниками, постепенно в ней формируются присущие всем Юлиям аристократические манеры и избирательность в знакомствах.

Общие буквы в именах

Юлия

Александр

Совпадает 1 буква из 4 возможных (Л).

Если совпадает одна буква, нельзя утверждать, что все в этой паре будет безупречно. Вероятны ссоры, недопонимание, конфликты на пустом месте. Время от времени партнерам может казаться, будто они прибыли с разных планет. Однако стоит помнить о том, что эти трудности преодолимы. Главное — благополучно пережить период притирки, а дальше уже определенно будет легче.

БукваЗначение
ЛЛюди с буквой «Л» в имени — творческие личности, которые предпочитают неожиданные и неординарные ситуации. Их решают посредством своей развитой логики. Профессионально могут реализоваться в любой сфере. Поэтому профессию выбирают из личностных предпочтений.

Сексуальность

У Юлии с ранних лет масса поклонников, внимание которых она воспринимает как должное и с большим достоинством. Но настоящая любовь способна пробудить в ней чувственность и страсть, не оставив и малейшего следа от внешнего спокойствия.

Юлия не терпит грубости и пошлости, но и маменькин сынок тоже не мужчина ее мечты. Чаще всего Юлия ведет активную половую жизнь, которая не задевает ее сердце и душу. Просто она любит секс, и он не отождествляется у нее с любовью. Моральные принципы Юлии позволяют ей встречаться сразу с несколькими партнерами.

Голосование

Ваше отношение к паре
Отличная пара
100% (2 голоса)
Плохая пара
0% (0 голосов)
Много общего
100% (1 голос)
Разные интересы и взгляды на жизнь
0% (0 голосов)
Партнерам легко друг с другом
100% (1 голос)
Сложные взаимоотношения
0% (0 голосов)
Крепкий союз
100% (1 голос)
Отношения бытро закончатся
0% (0 голосов)
Сильная страсть между партнерами
100% (1 голос)
Слабое влечение
0% (0 голосов)
Отношения построены на уважении
100% (1 голос)
Много претензий и обид
0% (0 голосов)

Брак и семья, совместимость с мужскими именами

Юлия необычайно удачлива в семейной жизни. Рядом с ней всегда оказывается достойный мужчина, способный сделать ее счастливой. У женщины практически не бывает конфликтов с мужем и его родственниками, но это не значит, что ее семейная жизнь будет легкой. У Юлии трудный и переменчивый характер, к которому не всякий мужчина сможет притерпеться.

Юлия очень увлекается домашним хозяйством, ее дом можно назвать образцовым. Она хорошо готовит и консервирует, не делает ненужных трат и покупок. Женщина с удовольствием принимает гостей, она не скупа и не завистлива.

Ради мужа и детей Юлия готова пожертвовать успешной карьерой. Она не будет претендовать на лидерство в семье, но и манипулировать собой не позволит.

Для Юлии очень важна идеальная картинка семьи — чтобы со стороны казалось, что у нее все прекрасно, даже если это неправда. Она никогда не станет выносить «мусор из избы», чтобы не разрушить идеальную картинку. Для Юлии очень важно найти мужа с таким же подходом к жизни, тогда она точно будет счастлива.

Удачный брак для Юлии возможен с мужчинами по имени Василий, Владислав, Александр, Максим, Евгений, Кирилл, Эдуард, Павел и Геннадий. Избегать следует союза с Андреем, Анатолием, Филиппом, Николаем, Федором и Робертом.

Рейтинг взаимоотношений в разных сферах жизни

ХарактеристикаЗначение (от 1 до 5)Расшифровка
Секс1Партнеры могут иметь кардинально противоположные представления о сексе, обладать разными темпераментами. Достичь взаимопонимания в интимной сфере этой паре довольно непросто. Впрочем, если проявить максимум терпения и такта, ситуация может измениться.
Дружба2Разное мировоззрение не позволяет установить абсолютно гармоничные отношения, но найти общий язык вполне реально. Главное — идти на уступки, слушать и слышать собеседника.
Любовь3У этих партнеров есть что-то общее, но и различий предостаточно. Могут возникать перекосы в отношениях, однако ситуация не фатальна. Если эти люди подойдут к вопросу со всей серьезностью и ответственностью, у них вполне может сложиться любовный союз.
Деловые отношения4У таких людей, как правило, не возникает разногласий в деловой сфере. Они хорошо понимают друг друга, вне зависимости от занимаемой должности. Если и случаются трудности, эти личности всегда проявляют готовность к конструктивному диалогу.
Семья2Эти люди часто не слышат друг друга, а без этого, как известно, ни один брак долго не продержится. Однако если партнеры все же научатся этому ценному умению, шансы создать крепкую семью значительно возрастут.

Бизнес и карьера

В жизни Юлия не слишком честолюбива, поэтому редко достигает карьерных высот, тем более ее вполне устраивает роль домохозяйки. Работа для Юлии всегда будет на втором месте после семьи.

Юлия очень рано осознает, что у каждого человека есть слабые ниточки и умело за них дергает, поэтому из нее может получиться прекрасный психолог, педагог или воспитатель. Она может заниматься с трудными подростками, работать адвокатом или правозащитником.

Для Юлии не подойдет кропотливый труд, но зато у нее отличное чувство меры и отменный вкус. Она может быть успешным хореографом, дизайнером, модельером, художником, визажистом или гримером.

Хорошее коммерческое чутье поможет ей быть удачливой в бизнесе, звезды вообще благосклонны к Юлии в финансовом плане. Какую бы профессию Юлия не выбрала, она всегда будет старательна и ответственна, но ей всегда придется бороться с присущей всем Юлиям ленью.

Отношения

Александр умеет ухаживать, способен совершенно искренне проявлять интерес к своей избраннице, делать ей сюрпризы, дарить цветы. И сердце Юлии пленит эта романтичность. Но очень скоро она поймет, что ее возлюбленный довольно приземленный человек, лишенный каких-то творческих идей и устремлений. Если Юлия мечтает покорить мир, то Александр хочет создать семью, воспитывать детей, заниматься тем, что ему нравится.

На этой почве возможны разногласия и конфликты. Если оба молоды, вероятность расставания очень велика, каждый предпочтет идти своей дорогой. Но в более зрелом возрасте совместимость имен Александр и Юлия в отношениях станет гораздо лучше. Они поймут, что дополняют друг друга, поэтому будут готовы закрывать глаза на недостатки партнера.

Талисманы для Юлии

  • Планета-покровитель — Солнце.
  • Покровительствующий знак зодиака — Весы. Имя Юлия рекомендуется давать девочкам, родившимся под этим созвездием.
  • Удачное время года — лето, удачный день недели — воскресенье.
  • Счастливый цвет — желтый.
  • Тотемное растение — подсолнух и дуб. Подсолнух — это олицетворение счастья, радости и удачи. Подсолнуху всегда приписывались сильные магические свойства: он защищает от сглаза и порчи, отводит от дома неприятности. Дуб символизирует мудрость, долголетие, мощь и благородство.
  • Тотемное животное — стрекоза и олень. Стрекоза — это символ легкомысленности и быстроты, а также грациозности и легкости. Олень символизирует плодородие и мужественность, а также уединение и непорочность.
  • Камень-талисман — янтарь и сапфир. Янтарь способен поглощать негативную энергию, притягивать любовь и удачу. Янтарь является очень сильным любовным талисманом. Сапфир дарует умение отличать правду от лжи, не позволяет верить пустым обещаниям.

Популярные совместимости

ЮлияАлександр
Юлия и Андрей [ 67% ]Александр и Анастасия [ 76% ]
Юлия и Алексей [ 69% ]Александр и Елена [ 74% ]
Юлия и Дмитрий [ 78% ]Александр и Ольга [ 74% ]
Юлия и Евгений [ 69% ]Александр и Екатерина [ 76% ]
Юлия и Сергей [ 74% ]Александр и Анна [ 74% ]
Юлия и Владимир [ 76% ]Александр и Алина [ 65% ]
Юлия и Илья [ 60% ]Александр и Наталья [ 78% ]
Юлия и Максим [ 65% ]Александр и Галина [ 76% ]

Гороскоп для Юлии

Овен

— настоящая воительница, готовая растоптать всякого, кому с ней не по пути. Она абсолютно самодостаточна, но не равнодушна к комплиментам и лести. Юлия-Овен хороший манипулятор, но сама никогда не выставляет напоказ свои слабости и недостатки. Юлия не может находиться в обществе, где ей не дадут духовно развиваться и применять свои многочисленные таланты, поэтому она всегда стремится попасть в аристократические круги. Юлия-Овен легко может обойтись в жизни без мужчины, но, как и любая женщина, мечтает о семейном счастье. Лучшей партией для нее может стать мужчина-Стрелец — их семейный союз будет прочным, плодотворным и нескучным.

Телец

— корыстная, упрямая и не очень честная натура, но всегда сдержанная и хорошо владеющая собой. Мудрость и практичный ум дарованы ей природой, но она не всегда умеет найти им достойное применение, так как ленива и не целеустремленна. Юлия-Телец во всем, что происходит вокруг нее, способна найти здравый смысл, что позволяет ей браться только за те дела, что наверняка будут успешными. Все свои дела она делает медленно, вдумчиво и аккуратно, и не стоит ее поторапливать. Составить семейное счастье Юлии-Тельцу сможет мужчина-Дева — они оба рациональны и сильно привязаны к дому и семье.

Близнецы

— противоречивая личность, умеющая с честью выходить из любой ситуации. Ее природная двойственность является одновременно слабостью и оружием Юлии-Близнецов. Легкость и чувственность легко уживаются в ней с рационализмом и расчетливостью, а самоуверенность с ранимостью и сентиментальностью. Где-то в глубине души Юлия-Близнецы считает себя идеалом, а всех остальных своими верными подданными. Сделать счастливой такую непростую женщину сможет мужчина-Лев — эта пара всегда сможет найти общий язык друг с другом.

Рак

— впечатлительная, но скрытная натура, для которой очень важна любовь. Жизнь без любви не имеет никакого смысла для Юлии-Рака, она очень тяжело переживает любовные неудачи. Приступы меланхолии у нее сменяются безудержной веселостью. Она очень боится неопределенности, поэтому старается жить экономно и откладывать деньги. В любви Юлия-Рак обычно делается тенью своего мужчины, но она никогда не остановит свой выбор на финансово несостоятельном человеке. Для нее очень важна поддержка мужа, она постоянно хочет слышать от него слова любви и одобрения — тогда у нее буквально вырастают крылья. Стать надежной опорой в жизни для женщины сможет мужчина-Телец — для них обоих на первом месте будет стоять дом и семья, а все остальное второстепенно.

Лев

— требовательная к себе и окружающим личность, гордая и уверенная. Она не терпит никакой критики в свой адрес, при возможности всегда отомстит своему обидчику. Природный оптимизм позволяет ей легко переживать все промахи и неудачи и шагать по жизни с гордо поднятой головой. Юлия-Лев настоящий боец и победитель, ее место в высшем обществе, к которому она всегда стремится. Она умеет жить полной жизнью, и дело тут вовсе не в количестве денег. Гордость — это ее и слабость и сила одновременно. Жить с Юлий-Львом очень непросто, но это может получиться у мужчины-Весов — природная гибкость и умение подстраиваться, характерные для этого знака, смогут сделать этот брачный тандем удачным.

Дева

— строгая и требовательная женщина, боец по натуре. От нее не стоит ждать порывов нежности и сентиментальности, она не будет выставлять свои чувства напоказ. Юлия-Лев не любит публичности, предпочитает домашнее времяпровождение шумным вечеринкам с друзьями. Она не из тех женщин, кто способен влюбиться с первого взгляда, за ней надо долго и красиво ухаживать. Духовное единение она ценит куда выше приземлённой плотской любви. Ей нужен партнёрский союз, в котором оба супруга будут уважать личное пространство друг друга. Идеальным мужем для Юлии-Девы станет мужчина, рожденный с ней под одним знаком зодиака. Союз двух Дев — это просто удивительное духовное единение, такое важное для обоих партнёров.

Весы

— это женщина с мужской логикой, практичная и умная. Она не стремится демонстрировать миру свои таланты, но окружающие всегда замечают в ней мудрость и душевность. При этом она старается избегать любой ответственности, что мешает ей достичь больших карьерных высот. Юлия-Весы всегда тактична и деликатна, абсолютно самодостаточна. Для своего любимого человека она готова практически на все, она с готовностью будет выполнять все его капризы и прихоти. При этом она является превосходным манипулятором, и ее муж даже не заметит, что главный в семье вовсе не он. Хорошей партией для Юлии-Весов станет мужчина-Козерог — их брак имеет все шансы продлиться всю жизнь.

Скорпион

— таинственная и загадочная личность, всегда уверенная в себе, гордая и независимая. Она очень стремится к лидерству, и роль матери-домоседки ей категорически не подойдет. Юлию-Скорпиона почти невозможно обмануть, она очень тонко чувствует людей и умело этим пользуется. Она относится к тому типу женщин, которые умеют заставлять плясать под свою дудку толпы людей. Но, несмотря на это, она очень чувствительна и ранима, и как никто нуждается в любящем и заботливом мужчине. Составить семейное счастье этой непростой женщине сможет мужчина-Дева — у них идеальная совместимость гороскопов.

Стрелец

— прямолинейная, справедливая натура, настоящий боец за правду. Из-за своей амбициозности и стремлении всегда и везде говорить правду она наживает себе иного врагов. Переубедить Юлию-Стрельца практически невозможно, у нее на все есть собственное мнение. При этом она не меркантильна и не карьеристка, умеет преданно дружить и искренне любить. Она способна на глубокие переживания, хотя внешне это совсем не заметно. К сожалению, у Юлии-Стрельца имеются все шансы остаться старой девой, так как у нее очень высокие требования к своему избраннику. Им сможет соответствовать мужчина-Скорпион — их будет тянуть друг к другу буквально с первого взгляда.

Козерог

— умная, воспитанная и начитанная женщина, обычно делающая неплохую карьеру. Она максималистка по натуре, ей нужно все или ничего. Юлия-Козерог всегда предельно сдержана и горда, особенно с мужчинами. Но в душе она тонкая, ранимая и очень чувственная женщина. Она с упоением занимается работой и карьерой, но ради любимого человека может все бросить в одночасье. От удачной личной жизни она хорошеет и добреет, а без любви она делается стервозной карьеристкой. Стать счастливой Юлия-Козерог может стать с мужчиной-Тельцом — им будет комфортно вместе.

Водолей

— ориентированная на социум женщина, общительная и жизнерадостная. У нее всегда много друзей, она очень чуткая и всегда готова прийти на помощь. Юлии-Водолею очень важно чувствовать себя нужной и полезной, но ей небезразлично мнение о ней окружающих. Она всегда стоит на страже интересов добра и справедливости, но всячески старается избегать конфликтов. Хитрые и коварные планы — это не про Юлию-Водолея, она никогда не пойдет в погоне за собственной выгодой «по головам» других людей. Она определенно пришла в этот мир для того, чтобы сделать его лучше. В браке для нее очень важно душевное тепло и взаимопонимание, которое ей сможет дать мужчина-Весы — партнёры будут говорить на одном языке и понимать друг друга с полуслова.

Рыбы

— сентиментальная, нежная и романтичная натура, которая любую мелкую неприятность воспринимает как катастрофу. Она имеет отзывчивое сердце и всегда стремится отдавать людям, а не брать, чем многие и пользуются. Она покорно ждет сое счастье, ничего не делая, чтобы хоть как то его приблизить. У Юлии-Рыб очень богатое воображение. И часто она живет в своем собственном мире, далеком от реальности. Этот выдуманный мир спасает ее от депрессии и меланхолии, к которым она имеет склонность. Стать надежным защитником в жизни для Юлии-Рыбы сможет мужчина-Скорпион — он прочно стоит на ногах и будет хорошей опорой для своей непрактичной жены.

Значение имени Юлия по сезону рождения

Значение имени Юлия можно трактовать в зависимости от сезона, в котором она родилась. Если представительница имени родилась зимой, она достаточно организована и умна. Чаще всего она холодна и сдержана с мужчинами. Вместе с тем, она является романтичной натурой и мечтает о большой любви.

Юлия, которая родилась весной, очень чувствительная натура. Она настоящая мечтательница, ее фантазии и воображению можно только позавидовать. Она всегда совершенствуется, стремится к непрерывному развитию. «Весенняя» Юлия любит созидать, творить, проявлять себя творчески. Она очень общительна, поэтому вокруг нее всегда много друзей, товарищей и знакомых. Она отдаст свое предпочтение только тому мужчине, который сможет добиться ее расположения. Сделать это будет непросто, ведь девушка всегда окружена толпой поклонников, с которыми придется соперничать. Юлия, рожденная летом, очень добрая и ласковая. Она осторожна в общении с окружающими, всегда подбирает правильные слова, относится с уважением. Ее терпение неисчерпаемо. У «летней» Юли есть жизненные принципы, которых она придерживается до конца. Если она любит мужчину, то никогда ему не изменяет. Ее чувство справедливости до такой степени обострено, что порой во благо его она действует в ущерб себе. Она всегда защищает слабых и беззащитных, но без надобности не вмешивается в чужие дела.

«Осенняя» Юлия, напротив, замкнута и скрытна. Она больше слушает, чем говорит. Она идет проторенной дорожкой, поскольку является достаточно практичной. Очень часто Юля, родившаяся осенью, разочаровывается в любви. Она быстро влюбляется, бросается в омут с головой, но затем разочаровывается. Несмотря на то, что в бытовых вещах она прагматична, в делах любовных она крайне не собрана и не всегда благоразумна. Чтобы точно понять, что означает имя Юлия, нужна первоначально узнать месяц рождения.

Соотношения имен для брака. Совместимость мужских и женских имён в браке и любви

Совместимость имен
Мужские имена совместимость Женских имён

| имена значение | тайна имени | тайна фамилии | вибрация имени | буква имени | имя для ребенка |

Совместимость мужских имён.

Имена буква -

A

Совместимость имен: Адам
с Антониной, Богданой,Бетой, Евой, Мирой, Ноной, Олесей, Полиной, Эльзой, Ярославой.

Сложные отношения: с Адой, Беллой, Варварой, Доминикой, Лидией, Лесей, Светланой, Софьей, Моникой.

Совместимость имен: Альфред
с Ириной, Натальей,Станиславой,Стеллой,Розой,Роксаной.

Сложные отношения с Екатериной, Еленой, Яна,Зинаидой, Лидией.

Совместимость имен: Александр
с Анной, Валентиной, Варварой, Верой, Вероникой, Дарьей, Елизаветой, Зоей, Инной, Любовью, Людмилой, Марией, Надеждой, Натальей, Оксаной, Полиной, Тамарой.
Сложные отношения с Екатериной, Еленой, Зинаидой, Лидией, Светланой.

Совместимость имен: Алексей с
Анастасией, Анжелой, Анной, Варварой, Галиной, Клавдией, Ларисой, Любовь, Надеждой, Светланой.
Не так благоприятны отношения с Верой, Оксаной, Тамарой, Юлией.

Совместимость имен: Анатолий с
Марией, Валерией, Галиной, Ириной, Светланой, Ольгой, Татьяной.
Сложности с Екатериной, Еленой, Аллой, Анжелой, Антониной, Мариной, Надеждой, Кларой, Ниной, Полиной, Верой, Юлией.

Совместимость имен: Андрей с
Еленой, Елизаветой, Ириной, Клавдией, Ларисой, Людмилой, Марией, Наташей.
Неблагоприятен союз - с Варварой, Зоей, Кларой, Оксаной, Ольгой, Софьей, Юлией.

Совместимость имен: Антон с
Валерией, Екатериной, Мариной, Ириной.
Совместимость имен: Аркадий с
Анной, Валентиной, Евгенией, Людмилой, Наталией, Оксаной, Олесей, Софьей.
Неблагоприятными отношения с Александрой, Галиной, Ниной, Тамарой, Татьяной.

Совместимость имен: Артём с
Анной, Ларисой, Людмилой, Тамарой.
Не очень подходят для серьезных отношений Зоя, Майя, Марина.

Совместимость имен: Аркадий с
Анной, Валентина, Евгения, Людмила, Ларисой, Людмилой, Натальей, Оксана, Олеся, Софья.
Не очень подходят: Александра,Галина, Нина, Тамара, Татьяна Зоя, Майя.

Имена буква -

Б

Совместимость имен: Богдан совместим с именами
Аннa, Анастасия, Светлана, Юлия, Варвара, Венера, Виктория,Елена, Надежда, Ольга, Нелли.
Не совместимы будут отношения с; Анжеллой, Валерией,Кларой, Ниной, Вандой, Диной, Оксаной,Тамарой, Яной.

Совместимость имен: Борис с
Анной, Валентиной, Валерией, Варварой, Вероникой, Зоей, Инной, Ириной, Кларой, Ларисой, Натальей, Ольгой, Светланой, Тамарой.
Неудачными будут отношения с Любовью, Мариной, Надеждой, Ниной, Татьяной, Юлией.

Имена буква -

В

Совместимость имен: Валентин с
Анжелой, Валентиной, Викторией, Дарьей, Марией, Мариной.
Вызывает сомнение брак с Антониной, Елизаветой, Надеждой, Тамарой.

Совместимость имен: Валерий с
Зоей, Викторией, Галиной, Надеждой, Олесей, Светланой, Татьяной.
Сложные отношения с: Верой, Зинаидой, Ириной, Кларой, Ларисой, Маргаритой, Тамарой.

Совместимость имен: Василий с
Маргаритой, Олесей, Юлией, Анной.
Неудачный брак - с Лидией, Инной, Екатериной, Любовью, Еленой.

Совместимость имен: Виктор с
Валентиной, Галиной, Зоей, Инной, Клавдией, Кларой, Ларисой, Любой, Майей, Марией, Ниной, Оксаной, Ольгой.
Трудности с Вероникой, Евгенией, Екатериной, Зинаидой.

Совместимость имен: Виталий с
Екатериной, Зинаидой, Антониной, Кларой, Лидией, Никой, Марией, Надеждой, Полиной, Тамарой.
Трудности с Зоей, Анастасией, Вероникой, Викторией, Майей, Маргаритой.

Совместимость имен: Владимир с
Аллой, Анжелой, Валентиной, Зинаидой, Варварой, Вероникой, Евгенией, Инной, Ириной, Любовь, Натальей, Раисой, Светланой, Софьей.
Мало шансов на удачный брак с Майей, Елизаветой, Лидией, Надеждой, Ниной.

Совместимость имен: Владислав с
Галиной, Клавдией, Ириной, Любовью, Софьей, Мариной, Ольгой, Юлией, Тамарой.
Сложности с Анжелой, Зинаидой, Валерией, Маргаритой, Верой, Вероникой, Майей, Наталией, Татьяной, Риммой.

Совместимость имен: Всеволод с
Верой, Вероникой, Клавдией, Полиной, Элеонорой.
Сомнительны отношения с Евгенией, Жанной, Аллой, Мариной, Оксаной, Риммой, Светланой.

Совместимость имен: Вячеслав
с Анной, Еленой, Ириной, Ларисой, Маргаритой, Марией, Эльвирой, Юлией.
Трудными будут отношения с Беллой, Зинаидой, Оксаной, Татьяной, Юлией.

Совместимость имен: Геннадий
с Валентиной, Верой, Ириной, Лидией, Любой, Майей, Натальей, Ольгой.
Надо остерегаться брака с Ангелиной, Виолеттой, Оксаной, Риммой, Тамарой, Татьяной.

Совместимость имен: Георгий с
Варварой, Верой, Галиной, Натальей, Ниной, Светланой.
Трудно ужиться с Викторией, Екатериной, Инной, Лидией, Светланой.

Совместимость имен: Глеб
с Софьей, Тамарой, Валентиной, Евгенией, Майей, Раисой, Марией.
Будет трудно с Викторией, Екатериной, Инной, Лидией, Светланой.

Совместимость имен: Григорий с такими именами
Вера, Алла, Елизавета, Лидия, Оксана, Мария, Тамара, Татьяна.
Непрочный брак с Анжелой, Викторией, Еленой, Ларисой, Наташей.

Совместимость имен: Даниил с
Анной, Любовью, Людмилой, Ниной, Олесей, Ольгой, Полиной, Тамарой, Татьяной, Эльвирой.
Маловероятны отношения с Елизаветой, Ириной, Ангелиной, Ксенией.

Совместимость имен: Денис с
Александрой, Анной, Екатериной, Ларисой, Евгенией, Клавдией, Мариной, Полиной, Софьей.
Непрочным будет союз с Антониной, Зинаидой, Зоей, Инной, Ириной, Ольгой.

Совместимость имен: Донат с
Вера, Мария, Анна, Ольга, Нелли, Полина, Светланой.
Не совместимы будут отношения с именами: Тамара, Инна, Клара, Владлена, Зинаида.

Совместимость имен: Дмитрий с
Анной, Еленой, Любовью, Людмилой, Наталией, Эльвирой.
Не стоит связывать судьбу с Анжелой, Викторией, Зинаидой, Инной, Ириной, Марией, Ниной, Софьей, Юлией.

Совместимость имен: Евгений с
Анной, Валентиной, Валерией, Верой, Дарьей, Ксенией, Людмилой, Наталией, Ниной, Раисой, Юлией.
Меньше подходят для брака Варвара, Елена, Зоя, Клавдия, Марина.

Совместимость имен: Егор
с Верой, Евгенией, Надеждой, Ниной, Татьяной.
Трудности с Валерией, Варварой, Галиной, Елизаветой, Людмилой, Майей, Полиной.

Совместимость имен: Захар
с Анной, Валентиной, Верой, Ириной, Любовь, Надеждой, Наташей, Ольгой, Полиной.
С Александрой, Дарьей, Инной, Светланой брак может быть неудачен.

Совместимость имен: Игорь совместим с именами
Алла, Ангелина, Вероника, Елена, Ирина, Наталья, Оксана, Олеся.
Не совместим с именами: Алла, Ангелина, Елизавета, Любовь, Людмила, Ольга, Полина, Раиса, Татьяна, Тамара.

Совместимость имен: Иван и
Алла, Валентина, Дарья, Екатерина, Елизавета, Зоя, Ирина, Клавдия, Мария.
Мало подходит Варвара, Елена, Зинаида, Лариса, Лидия, Майя, Надежда, Римма.

Совместимость имен: Илья и
Анна, Вера, Наталья, Софья.
Менее подходят для брака Галина, Елизавета, Маргарита, Татьяна.

Совместимость имен: Кирилл
с Аллой, Анжелой, Еленой, Маргаритой, Оксаной, Риммой, Эльвирой.
Не совместим с Валерией, Екатериной, Лидией, Майей, Мариной, Надеждой, Элеонорой.

Совместимость имен: Константин
с Анной, Викторией, Евгенией, Инной, Любовью, Полиной, Риммой, Софьей.
Не подойдут для брака Александра, Вероника, Ирина, Клавдия, Мария, Наташа, Ольга.

Совместимость имен: Лев
с Анной, Викторией, Ольгой, Ириной, Клавдией, Тамарой, Полиной, Элеонорой.
Скорее всего, ему не подойдут Лидия, Марина, Оксана, Олеся.

Совместимость имен: Леонид
с Аллой, Анной, Валентиной, Верой, Вероникой, Людмилой, Натальей, Полиной, Элеонорой, Эльвирой, Юлей.
Трудна семейная жизнь с Галиной, Жанной, Инессой, Любовью, Татьяной.

Совместимость имен: Максим и
Виолетта, Зинаида, Лидия, Маргарита, Нина, Раиса, Светлана, Виктория
Мала вероятность хорошего брака с Антониной, Любовью, Ольгой, Юлией.

Совместимость имен: Михаил
с Александрой, Варварой, Верой, Дианой, Диной, Еленой, Елизаветой, Кларой, Лидией, Мариной, Ниной, Раисой, Риммой, Тамарой, Эльвирой.
Семейная жизнь может не сложиться с Елизаветой, Оксаной, Ольгой, Софьей.

Совместимость имен: Никита и
Вера, Алла, Ирина, Клавдия, Людмила, Наталья,
Светлана.
Следует остерегаться брака с Анастасией, Анжелой, Валерией, Жанной, Любой, Татьяной.

Совместимость имен: Николай
с Анной, Дарьей, Зинаидой, Зоей, Ларисой, Любовью, Эльвирой.
Следует остерегаться брака с Аллой, Валентиной, Вероникой, Галиной, Евгенией, Екатериной, Еленой, Елизаветой, Инной, Людмилой, Мариной, Олесей, Ольгой, Риммой, Юлией.

Совместимость имен: Остап
совместим с Антониной, Анфиса, Богданой, Еленой, Риммой.
Не совместим с именами Алевтина, Лилия, Таисия, Екатерина.

Совместимость имен: Олег
с Антониной, Кларой, Ларисой, Майей, Натальей, Риммой, Светланой, Софьей, Татьяной, Элеонорой.
Неудачным брак может быть с Ангелиной, Варварой, Верой, Дарьей, Екатериной, Елизаветой, Ниной, Ольгой, Оксаной, Мариной

Совместимость имен: Павел
с Верой, Диной, Екатериной, Елизаветой, Зинаидой, Майей, Серафимой, Софьей, Эльвирой.
Трудным брак может оказаться с Анжелой, Дарьей, Натальей, Ниной, Татьяной, Юлией.

Совместимость имен: Пётр
и Ангелина, Варвара, Вера, Вероника, Диана, Евгения, Екатерина, Лариса, Людмила, Наталья, Светлана.
Неудачный брак может сложиться с Валерией, Диной, Еленой, Зинаидой, Мариной, Оксаной, Татьяной.

Совместимость имен: Роман
с Анной, Валентиной, Еленой, Клавдией, Любовью, Майей, Марией, Софьей.
Менее удачными будут отношения с Диной, Евгенией, Екатериной, Оксаной, Риммой, Тамарой.

Совместимость имен: Семен
с Ангелиной, Антониной, Валентиной, Валерией, Викторией, Диной, Екатериной, Зоей, Кларой, Майей, Ниной, Оксаной, Ольгой, Раисой, Тамарой.
В жены мало подходят Александра, Анна, Варвара, Вероника, Ирина, Марина, Светлана.

Совместимость имен: Сергей
с Валентиной, Викторией, Галиной, Дарьей, Диной, Елизаветой, Ириной, Любовью, Ниной, Риммой, Татьяной.
Сложно будет в браке Аллой, Верой, Ларисой, Элеонорой.

Совместимость имен: Станислав
с Вероникой, Еленой, Ларисой, Оксаной, Риммой, Тамарой, Элеонорой, Юлией.
Брак будет несчастным с Валентиной, Евгенией, Зинаидой, Мариной, Светланой, Софьей.

Совместимость имен: Степан
с Дарьей, Зинаидой, Ириной, Клавдией, Кларой, Лидией, Надеждой, Ольгой.
Трудности ждут с Анной, Еленой, Людмилой, Натальей, Оксаной, Раисой, Риммой.

Совместимость имен: Федор
с Анной, Варварой, Клавдией, Лидией, Любовью, Марией, Натальей, Раисой, Светланой.
Сложности возникнут в отношениях с Аллой, Екатериной, Майей, Надеждой, Ниной.

Совместимость имен: Филипп
и Инна, Ирина, Любовь (Люба), Маргарита, Тамара.
Вряд ли удачным будет брак с Дарьей, Евгенией, Марией, Надеждой, Раисой.

Совместимость имен: Эдуард
и Лидия, Римма, Светлана, Юлия.
Сложной будет семейная жизнь с Дарьей, Дианой, Клавдией, Ларисой, Людмилой, Майей, Марией.

Совместимость имен: Юрий
с Анжелой, Антониной, Галиной, Дарьей, Зинаидой, Ларисой, Лидией, Любовью, Натальей, Ольгой, Полиной, Раисой, Светланой, Софьей, Тамарой.
Мала вероятность удачного брака с Аллой, Вероникой, Елизаветой, Зоей, Татьяной.

Совместимость имен: Яков
с Галиной, Инной, Клавдией, Людмилой, Полиной, Тамарой.
Сложными отношения будут с Диной, Екатериной, Людмилой, Раисой.

Совместимость имен: Ярослав
с Анной, Валерией, Екатериной, Елизаветой, Ларисой, Лесей, Ниной, Оксаной, Светланой, Стеллой, Тамарой.
Не совместим может быть с Ангелиной, Беллой, Диной, Евой, Зинаидой, Ингой, Кларой, Стеллой, Эллой.

Совместимость женских имён.

Совместимость имен: Алла
с Александром, Виктором, Евгением, Михаилом, Петром, Владимиром, Яковом.
Мало подходят Дмитрий, Игорь, Алексей, Николай, Анатолий.

Совместимость имен: Альбина
с Владимиром, Иваном, Ильей, Кириллом, Никитой, Сергеем, Эдуардом.
Менее удачными будут отношения с Дмитрием, Захаром, Максимом, Романом, Филиппом.

Совместимость имен: Анастасия
с Борисом, Владимиром, Виктором, Константином, Денисом, Олегом, Павлом, Семеном.
Сложнее отношения будут складываться с Вадимом, Виталием, Николаем, Станиславом, Филиппом.

Совместимость имен: Ангелина
с Борисом, Виктором, Владимиром, Игорем, Петром, Семеном, Эдуардом.
Трудно будет ужиться с Геннадием, Олегом, Станиславом, Степаном, Анатолием.

Совместимость имен: Анжела
с Владимиром, Виктором, Валентином, Иваном, Максимом, Петром.
Скорее всего, брак будет неудачным с Игорем, Дмитрием, Анатолием, Владиславом, Эдуардом.

Совместимость имен: Анна
с Алексеем, Борисом, Евгением, Захаром, Константином, Степаном.
Неудачные отношения сложатся с Александром, Георгием, Сергеем, Львом, Станиславом.

Совместимость имен: Антонина
и Виталий, Олег, Сергей, Семен, Юрий.
Неудачным брак будет с Иваном, Игорем, Константином, Никитой, Федором.

Совместимость имен: Анфиса
и Александр, Валентин, Виктор, Михаил, Максим, Яков.
Менее подходят мужчины с именами Николай, Игорь, Роман, Семен, Эдуард.

Совместимость имен: Белла
с Артемом, Валерием, Григорием, Захаром, Игорем, Романом.
Неудачным будет брак с Александром, Василием, Глебом, Михаилом, Станиславом.

Совместимость имен: Богдана совметима
с Анатолием, Андреем, Станиславом, Владиславом, Григорием, Ярославом.
Не совместима будет с именами: Александром, Василием, Глебом, Михаилом, Фридрихом Матвеем.

Совместимость имен: Валентина
с Валентином, Владимиром, Глебом, Иваном, Сергеем, Семеном, Александром.
Непростыми отношения будут с Борисом, Георгием, Леонидом, Николаем, Станиславом, Юрием.

Совместимость имен: Валерия
и Анатолий, Борис, Антон, Илья, Никита.
Ей придется трудно с Вениамином, Кириллом, Петром, Владиславом.

Совместимость имен: Варвара и
Александр, Алексей, Борис, Владимир, Георгий, Михаил, Петр, Федор.
Меньше подходят Андрей, Олег, Семен, Иван, Егор, Евгений.

Совместимость имен: Вера
с Александром, Вадимом, Егором, Евгением, Захаром, Михаилом, Павлом, Яковом.
Лучше воздержаться от брака с Анатолием, Вячеславом, Владиславом, Олегом, Филиппом.

Совместимость имен: Вероника
с Александром, Борисом, Владимиром, Игорем, Леонидом, Петром, Станиславом.
Мало ей подходят Виктор, Владислав, Виталий, Константин, Николай, Семен, Эдуард.

Совместимость имен: Виктория
с Владимиром, Михаилом, Львом, Сергеем, Семеном, Эдуардом.
Отношения, скорее всего не сложатся с Александром, Виталием, Дмитрием, Григорием, Юрием.

Совместимость имен: Глория
с Александром,Альбертом, Борисом, Леонидом, Святославом, Сергеем, Яковом, Эдуардом.
Не совместима будет с именами: Адам, Николай, Степан, Сергей, Иван, Игорь, Ярослав.

Совместимость имен: Галина
с Алексеем, Валерием, Виктором, Георгием, Павлом, Станиславом, Яковом.
Неудачно - с Егором, Кириллом, Леонидом, Николаем, Романом.

Совместимость имен: Дарья
с Александром, Антоном, Иваном, Евгением, Сергеем, Юрием.
Жизнь может не сложиться в браке с Олегом, Семеном, Федором, Филиппом, Алексеем.

Совместимость имен: Диана
с Борисом, Андреем, Михаилом, Петром, Романом, Станиславом.
Сложными будут отношения с Владиславом, Глебом, Даниилом, Константином, Львом, Олегом.

Совместимость имен: Дина и
Антон, Глеб, Лев, Павел, Сергей, Яков.
Могут не сложиться отношения в браке с Анатолием, Кириллом, Николаем, Петром, Федором.

Совместимость имен: Екатерина
с Антоном, Виталием, Денисом, Петром, Павлом, Семеном.
Неудачно - с Виктором, Кириллом, Николаем, Филиппом, Яковом.

Совместимость имен: Елена
с Андреем, Дмитрием, Игорем, Захаром, Константином, Романом, Станиславом.
Неудачно могут сложиться брачные отношения с Анатолием, Василием, Иваном, Степаном.

Совместимость имен: Елизавета
с Александром, Иваном, Михаилом, Никитой, Эдуардом.
Маловероятен удачный брак с Валентином, Николаем, Олегом, Станиславом.

Совместимость имен: Жанна
с Артёмом, Вадимом, Дмитрием, Максимом.
Не сложатся отношения с Афанасием, Борисом, Олегом, Семеном.

Совместимость имен: Зарина и
Александр, Виктор, Даниил, Дмитрий, Иван, Ярослав.
Будет не совместима с Адамом, Владимиром, Сергеем, Евгением, Юрием.

Совместимость имен: Зинаида и
Владимир, Виктор, Павел, Захар, Степан, Ярослав, Юрий.
Не совместима: с Адольф, Денис, Станислав, Иван, Янус, Яков.

Совместимость имен: Злата и
Альберт,Артём, Михаил, Игорь, Сергей, Эдгар, Эдуард, Эмиль.
Не совместима с именами: Анатолий, Геннадий, Станислав, Марат, Харитон, Петр, Юрий.

Совместимость имен: Зоя и
Александр, Борис, Валерий, Виктор, Иван, Семен.
Следует остеречься замужества с Виталием, Евгением, Ильей, Кириллом, Юрием.

Совместимость имен: Инга
с Алексей, Олесь, Владислав, Геннадий, Мирон, Филипп.
Не совместима: с Адамом, Анатолием, Альбертом, Артемием, Лаврентием, Василием.

Совместимость имен: Иванна
с Александром, Анатолием, Афанасием, Денисом, Евгением, Казимиром, Николаем, Харитоном, Захаром.
Не совместима с именами: Семён, Назар, Богдан, Орест, Оскар, Евдоким.

Совместимость имен: Инна
с Алексеем, Александром, Владимиром, Константином, Петром, Яковом.
Менее удачным может получиться брак с Вадимом, Василием, Иваном, Николаем, Романом.

Совместимость имен: Ирина
с Андреем, Борисом, Иваном, Леонидом, Сергеем, Степаном, Игорем
Меньше повезет с Валерием, Дмитрием, Константином, Романом.

Совместимость имен: Клавдия
с Алексеем, Андреем, Виктором, Романом, Федором.
Неудачно отношения в браке могут сложиться с Константином, Никитой, Сергеем, Юрием.

Совместимость имен: Клара
с Борисом, Виктором, Михаилом, Олегом, Семеном, Степаном.
Менее удачным будет брак с Анатолием, Валерием, Денисом, Станиславом.

Совместимость имен: Лариса
с Аркадием, Георгием, Максимом, Юрием.
Лучше воздержаться от брака с Григорием, Иваном, Эдуардом.

Совместимость имен: Лидия
с Алексеем, Максимом, Михаилом, Сергеем, Эдуардом.
Маловероятен счастливый брак с Василием, Глебом, Львом, Иваном, Кириллом.

Совместимость имен: Любовь
с Алексеем, Александром, Виктором, Геннадием, Глебом, Константином, Юрием.
Маловероятен удачный брак с Борисом, Игорем, Станиславом.

Совместимость имен: Людмила
с Александром, Андреем, Дмитрием, Евгением, Кириллом, Ильей.
Следует быть осторожней с Егором, Николаем, Степаном, Эдуардом.

Совместимость имен: Майя
с Виктором, Вадимом, Денисом, Павлом, Степаном.
Лучше воздержаться от отношений с Владиславом, Егором, Никитой, Фёдором, Эдуардом.

Совместимость имен: Мария
с Анатолием, Александром, Виктором, Григорием, Валентином, Евгением, Иваном.
Сложными отношения будут с Борисом, Вячеславом, Кириллом, Эдуардом.

Совместимость имен: Марина
с Антоном, Валентином, Владимиром, Денисом, Михаилом, Сергеем.
Неудачен брак, скорее всего, будет с Анатолием, Борисом, Георгием, Николаем, Станиславом.

Совместимость имен: Надежда
с Александром, Виталием, Егором, Константином, Юрием.
Неудачным будет брак, скорее всего с Анатолием, Владимиром, Иваном, Федором.

Совместимость имен: Наталья
с Александром, Андреем, Борисом, Владимиром, Олегом, Юрием.
Неудачными отношения в браке могут быть с Владиславом, Григорием, Захаром, Никитой, Степаном.

Совместимость имен: Нина
с Валентином, Виктором, Георгием, Михаилом, Семеном, Сергеем.
Большие сложности в семейной жизни будут с Анатолием, Дмитрием, Иваном, Фёдором.

Совместимость имен: Олеся
с Аркадием, Валерием, Василием, Игорем, Филиппом, Яковом.
Менее подходит для брака Артем, Николай, Станислав, Федор.

Совместимость имен: Ольга
с Анатолием, Виктором, Владиславом, Захаром, Львом, Семеном, Степаном.
Менее вероятно счастье с Денисом, Игорем, Константином, Николаем.

Совместимость имен: Полина
с Александром, Виталием, Денисом, Константином, Юрием.
Могут быть неудачными отношения с Анатолием, Вадимом, Игорем, Станиславом, Филиппом.

Совместимость имен: Раиса
с Владимиром, Глебом, Евгением, Михаилом, Сергеем, Сергеем, Юрием.
Брак будет непрочным с Андрей, Дмитрий, Пётр, Рустам, Фёдор.

Совместимость имен: София
с Александром, Владимиром, Борисом, Евгением, Юрием, Алексеем, Борисом.

Совместимость имен: Светлана
с Вадимом, Владимиром, Олегом, Эдуардом, Юрием, Алексеем, Борисом.
Возможны серьезные осложнения в браке с Александром, Глебом, Дмитрием, Михаилом, Станиславом.

Совместимость имен: Татьяна
с Анатолием, Валерием, Иваном, Олегом, Сергеем.
Маловероятен удачный брак с Вячеславом, Геннадием, Кириллом, Станиславом, Филиппом.

Совместимость имен: Элеонора
с Антоном, Игорем, Михаилом, Петром, Семеном.
Меньше всего шансов - с Анатолием, Владимиром, Николаем, Львом.

Совместимость имен: Эльвира
с Александром, Борисом, Виктором, Евгением, Сергеем.
Неудачным может стать брак с Олегом, Павлом, Петром, Семеном.

Совместимость имен: Юлия
с Василием, Владиславом, Евгением, Кириллом, Эдуардом.
Под вопросом –отношения в браке с Анатолием, Андреем, Николаем, Фёдором, Филиппом.

Совместимость имен: Ядвига
с Антоном, Сергеем, Семёном, Петром, Игорем,Михаилом.
Не совместима: с Анатолием, Андреем, Владимиром, Николаем, Евдокимом, Рудольфом, Леонтием.

Совместимость имен: Яна
с именами: Александр, Алексей, Василием, Дмитрий, Егор, Степан, Николай, Федор, Эдуардо.
Не совместимость с именами: Богдан, Вадим, Денис, Игнатий, Руслан.

#*************************************************************************#

| | | | | |

| | | |
| | | | |

Основные числа имени – это Число Судьбы, Число Души и Число Внешнего Облика. То есть возможности, желания и образ, «имидж». Оценка совместимости по совокупности этих показателей – задача достаточно сложная, требующая внимательного и серьезного подхода. Оставить без внимания явное несоответствие по любому из этих параметров – значит совершить ошибку, которая может иметь крайне негативные последствия.

Совместимость по буквам имени

Оценке совместимости по буквам имени отдают предпочтение те, кому важно получить представление обо всех уровнях личности партнера: физическом, ментальном, эмоциональном и интуитивном; те, кто умеет видеть в заложенных качествах не столько «экипировку», необходимую для выполнения определенных функций, сколько потенциал, предполагающий развитие и совершенствование.

Полученные знания позволяют этим людям создавать отношения, далеко выходящие за рамки сугубо межгендерных. Они становятся не только супругами, но и наставниками, опекунами, создающими условия для того, чтобы личность партнера могла раскрыться в полной мере и во всех возможных планах. Это залог обретения высочайшего морального удовлетворения, намного «перевешивающего» так называемые «простые житейские радости». И результатом такого подхода становится возникновение исключительно тесной духовной связи, подлинной близости.

Достаточно важную роль в супружеских и любовных отношениях между мужчинами и женщинами. Это проявляется и в повседневном общении, и в интимной сфере.

Тест на совместимость имен:

Некоторые ученые считают, что определенное совпадение вибраций и созвучности в именах может положительно сказываться на гармонизации взаимоотношений между людьми. Было также замечено, что на мужчин с именами определенного типа весьма возбуждающе действует конкретный тип женских имен и наоборот. Поэтому совместимость имен в любви имеет немалое значение. При этом следует обращать внимание и на то, что имена награждают своих носителей индивидуальными чертами и определенными личностными свойствами. Вследствие этого достаточно часто наблюдается притяжение людей одного типа к другому. Например, может случиться так, что человеку часто приходится знакомиться с людьми, имеющими одно и то же имя. Подобное подсознательное притяжение является доказательством того, что определенные имена совместимы друг с другом.

Относительно теории подобной совместимости имен бытует следующее мнение: чаще всего счастливо живут те пары, имена партнеров в которых совпадают по своему звуковому ряду . Как и любые слова, имена - это определенный набор звуков. Каждый из звуков воспринимается по-разному. Кого-то привлекает, кому-то безразличен, а кого-то отталкивает. Вот почему определенные имена, а, следовательно, и их владельцы, вызывают у нас соответствующее отношение. Немаловажная роль в совместимости имен отводится отчествам. Если имя обогащает своего хозяина определенными качествами, то отчество способно ослабить или усилить их. Если у людей, находящихся в паре, имена и отчества звучат слаженно, то и отношения между партнерами будут соответствующими.


К примеру, рассмотрим имена Игорь и Ирина. Не очень гармоничное сочетание. Имя Игорь звучит жестко, а Ирина - мягко. Но если взять эту же пару имен, но в сочетании с их отчествами, то мы услышим абсолютно другую музыку: Игорь Валерьевич - Ирина Сергеевна. Основное ударение в обоих отчествах приходится на 2-й слог - именно это и сглаживает «разноголосье» имен. Получается, что при произнесении имен на первое место в звучании выходит достаточно гармоничное сочетание Валерьевич - Сергеевна, а это и определяет благоприятную совместимость имен в любви и браке. Такая совместимость предвещает крепкие и слаженные отношения пары.

Совместимость имен для любви и брака

Вы собрались замуж? Тогда вполне может пригодиться таблица онлайн «Совместимость имен для любви и брака». Если женское сердце испытывает хоть малейшие сомнения, да и показания таблицы подтверждают, что есть проблемы, то нужно все еще раз тщательно обдумать.
Настало время проверить онлайн совместимость имен в любви и браке бесплатно, отбросьте сомнения и проверяйте. Если тщательно проверить своего избранника накануне бракосочетания, то это поможет в будущей жизни обойтись без разочарований.
А если по таблице все складывается как нельзя лучше, значит, смело соглашайтесь на предложение своего любимого.


Телец по гороскопу (от латинского Taurus) - те, кто родились в период с 21 апреля по 20 мая.

Стихия Тельцов - Земля , а Венера - покровительствующая планета. Этот знак отличается от всех остальных тем, что Тельцы, как никто другой, могут отстраняться от окружающих, быть выше общественного мнения, но между тем оставлять о себе самые хорошие впечатления.

Основные характеристики

Положительные качества:
  • Телец добродетелен. В то время как окружающие «борются» за место под Солнцем, он спокойно живет в своем гармоничном пространстве, миролюбиво относясь ко всему происходящему.
  • Тельцы способны концентрироваться на чем-то одном и, благодаря этому качеству, быстро достигают успеха.
  • Тельцы разводятся очень редко. Пусть духовно, но они остаются верны своему партнеру. Все благодаря планете Венере, которая заставляет девушек влюбляться без остатка, а влюбленных юношей-Тельцов совершать романтические поступки: петь серенады под окном, осыпать любимую лепестками роз и так далее.
Отрицательные качества:
  • Упрямство и сверхосторожность - главные недостатки Тельцов. Из-за того, что они боятся совершать поступки, не обдумав их, счастливые возможности просто проходят мимо.

С ними легко общаться, они поддержат любую беседу, проникнутся в проблемы других, но к себе в душу предпочитают никого не впускать. Вроде бы открытые и дружелюбные, они окружены загадкой . Они могут поддерживать разговор и «не слышать», не поддерживать вашу идею. И как бы вы ни старались, не аргументировали свои доводы, от Тельца можно не дождаться даже простого одобрительного кивка головы.

Тельцы не из тех, которых можно «прочесть» как открытую книгу. Модель их сегодняшнего поведения закладывается еще в детстве. Однако такие чувства, как страх, боль, радость, счастье лежат на поверхности. В этом Тельцы открыты.

Они умеют «отгораживаться» от внешнего мира. Не уходить в себя, а просто не впускать эмоции извне внутрь своего сознания, где и так кипит буря чувств. Они способны жить как на автопилоте: работать, делать повседневные дела, не отвлекаясь на внешние обстоятельства. Эта способность связана с подсознательным влечением к гармоничной и спокойной жизни.

Тельцы болезненно относятся к переменам в жизни , так как те заставляют Тельцов выходить из привычной зоны комфорта, что им совсем не по душе. Тельцы стараются заранее предвидеть возможные риски и делают все, чтобы обезопасить себя. На милость судьбы не надеются и строят свою завтрашнюю жизнь уже сегодня. В своих планах они расписывают жизнь на много лет вперед, и не любят когда кто-то хочет повлиять ни них, вникнуть в их дела.

Стихия Земля оказывает влияние на то, что Тельцу нравится заниматься материальными делами, нравится овладевать материальными ценностями. Телец стремится, чтобы и его жилище, и те вещи, которые его окружают, были красивы, даже роскошны. Старается достичь этого, не жалея энергии. Не удивительно, что у Тельцов особая страсть к деньгам. Однако деньги для них лишь способ получить удовольствия и не больше того.

Они любят одеваться красиво . И пусть одежда не будет от Кутюрье, для них главное, чтобы она была хорошо пошита и из качественных материалов. Их внешний вид напрямую связан с настроением и самочувствием. На протяжении многих лет в одежде стараются быть верными одному стилю. Не любят броские украшения, но обожают духи с нежным запахом.

Тельцы достаточно терпеливы . Их желание находиться в гармонии заставляет идти на уступки и мириться с неприятными ситуациями. Тельцов трудно довести до истерики, но когда их терпение иссякает, они просто громко хлопают дверью.

Не любят не продуманных действий. Стараются вновь и вновь заглянуть вперед для того, чтобы понять какие последствия ждать от сделанного шага.Тельцы не бросают слов на ветер, если уж обещали, то обещанное будет исполнено. У них великолепная память и закоренелый страх к рискам.

Драгоценные камни знака Зодиака Телец:
  • Бирюза
  • Изумруд
  • Хризопраз
  • Александрит
  • Берилл
  • Авантюрин

Женская форма имени Валентин: здоровый, сильный (лат.).

Валентин отличает большая доброта. Это заметно и в раннем детстве : Валюша поделится игрушкой, отдаст последнюю конфету, разделит на всех яблоко. Доброта Валентин жертвенная. Часто, соглашаясь помочь, Валентина создает себе дополнительные трудности и проблемы, хотя сама в данный момент нуждается, может быть, в большей помощи. Она не ждет награды за свой альтруизм, она делает это не из расчета или корыстных побуждений, а потому, что совершенно не в состоянии переносить чужое горе. Просьба для нее сигнал о помощи, она же сама как дежурный поста Доброты, готовый всегда проявить эту доброту.

У нее легкий, похожий чемто на весеннее солнце нрав. Она может легко вспылить, рассориться с лучшей подругой , но не проходит и двух минут, как она уже готова идти на примирение. И многие из тех, кто ее хорошо знают, безо всяких обид прощают ей эти вспышки, зная ее мягкий, отходчивый характер.

Валентина гостеприимный человек, легка на подъем, придя в гости, одной из первых бросается помогать хозяйке дома. Она вообще проста в общении, чаще всего весела, очень гостеприимна и сама любит ходить в гости. Валентина любит азартные игры, при игре очень увлекается, болезненно переживает проигрыш.

Замуж выходит по любви, но любовь ее часто вторична возникает в качестве ответного чувства к человеку, который вызывает у нее сострадание своей отчаянной любовью к ней. В семейную жизнь Валентина окунается с головой. Почти все свободное время она посвящает мужу и детям, не отказывается от заботы и о старых людях. Врагов у Валентины, можно сказать, и нет, есть завистники, но и их она часто обезоруживает своей добротой. И все же личная жизнь Валентин складывается не всегда удачно. В этом виноваты, главным образом, их мужья.

Наиболее удачны браки с Валентином, Александром. Владимиром, Глебом, Иваном, Сергеем, Семеном, наименее с Николаем, Леонидом, Георгием, Станиславом Борисом.

Женский вариант имени Валерий. Валерия непредсказуема. Порой ее поведение зависит от того, с какой ноги она встала. Если маленькая Валерия надуется, то это надолго. Вроде бы и повода для этого никто не давал, а Валерия не в духе. Так же без видимой причины, она через какое-то время станет веселой и ласковой: не стоит ломать голову над тем, почему это произошло, все равно не отгадаете.

Повзрослев, Валерия продолжает оставаться сложной и непредсказуемой. Она противоречива в оценке событий и людей, непостоянна в своих намерениях. Естественно, такой характер не очень-то располагает к себе. Впрочем, если у вас хватит терпения завоевать ее расположение или просто повезет ей понравиться, вы будете иметь преданнейшего друга, который упрямо будет видеть в вас только хорошее, даже если вы этого не заслуживаете. Тот, кто сможет проникнуть в характер Валерии глубже, увидит, что в основе взбалмошного поведения Валерии лежит ее ранимость, повышенная чувствительность. Мимолетный взгляд, брошенный мужем Валерии на проходившую женщину, не заметит никто, а Валерия приметит обязательно. И следствием этого может стать непонятный многим поступок, решительно испортившееся настроение.

К незнакомым людям у Валерии преобладает настороженно-недоверчивое отношение. В безобидных замечаниях свекрови она может усмотреть предвзятое к себе отношение, хотя другая невестка в такой же ситуации отнеслась бы к словам свекрови вполне спокойно.

Валерия заботливая, хозяйственная жена, дома у нее во всем порядок. Не любит ходить на вечеринки, в гости, предпочитает им домашнюю тишину и общение в кругу семьи. Ревнива, каждая новая женщина в окружении мужа вызывает у нее множество страхов и подозрений, унизительных для мужа допросов. Ревность Валерии нередко разрушает удачно складывающийся поначалу брак.

Женщине с таким непростым характером подойдет мужчина по имени Анатолий, Матвей, Семен, Борис, Антон. С Альбертом, Марком, Кириллом, Петром или Владиславом ей придется нелегко.

В детстве эти малышки доставляют немало проблем своим родителям и воспитателям плохим аппетитом, неспокойным нравом, чрезмерной эмоциональностью.

Упрямые и решительные, похожие больше на отца, они и друзей себе выбирают чаще среди мальчиков.

В школе и институте учатся неплохо, занимаются спортом (теннисом, волейболом). Любят "наводить порядок" и искать справедливость. В особенности это касается Ванд, рожденных зимой: они конфликтны, пытаются всеми командовать, навязывать свое мнение и спорить по пустякам; в жизни им приходится трудновато. "Летние" Ванды добрее, но с хитринкой.

Среди женщин с этим именем есть художники, инженеры, продавцы, портнихи, архитекторы, врачи, воспитатели детских садов, скорняки.

Брак у Ванды, как правило удачен, и обычно у них рождаются сыновья (за исключением "осенних"). Эти женщины всего добиваются в жизни своими силами: они и мужа выберут себе такого, какой соответствует их идеалу мужчины. Ванда прекрасная хозяйка, хотя и любит по утрам поспать подольше и не терпит мытья посуды. Дом у нее, тем не менее, всегда в полном порядке, и вкусный обед приготовлен. Она экономна в домашних тратах, действует не спеша, продумывая каждый шаг. Ванда не тип деловой женщины, карьере она предпочитает домашний круг, роль хранительницы домашнего очага. У нее много друзей, которых она охотно принимает дома. Имя Ванда чаще всего встречается на Украине и в Польше.

Идеалу Ванды будет соответствовать мужчина с именем Александр, Михаил, Сергей, Валентин, Семен или Аркадий; брак с одним из них наверняка сложится удачно. Мужчины же по имени Владлен, Игорь, Николай, Анатолий, Олег, Богдан ей не подходят.

Древнегреческого происхождения, означает: дикарка, варварка.

Девочка Варя безмятежное, улыбчивое, доброе создание. Это "папина дочка", похожая на отца как внешне, так и повадками. Она скромна, покладиста, трудолюбива, но несколько нерешительна и остается такой же, став взрослой.

"Зимние" неплохие спортсмены, увлекаются лыжным спортом. Рассудительны и замкнуты, свои обиды держат в себе. Неторопливы начав пело, не будут спешить с ним, пока не обдумают все обстоятельно.

"Летние" обидчивы и требовательны (не столько к окружающим, сколько к себе), они умеют подать себя, со вкусом одеться.

Варя большая домоседка, возможно, поэтому замуж выходит поздно и часто неудачно. Однако присущая ей терпеливость помогает сохранить брак.

В мужья такой женщине годится один из тех, чье имя Михаил, Петр, Федор, Георгий, Владимир, Борис, Александр, Алексей или Богдан. С ее именем плохо сочетаются такие мужские имена, как Серафим, Андрей, Олег, Семен, Иван, Лазарь, Егор, Владлен, Евгений.

По профессии Вари медсестры, педагоги, спортивные тренеры, библиотекари, портнихи, бухгалтеры, продавцы, художники.

В древнеримской мифологии Венера дочь Юпитера, Богиня весны, красоты и любви; в древнегреческой мифологии Афродита.

Растет слабой, беспокойной и болезненной девочкой, подвержена частым респираторным заболеваниям. Она внешне похожа на отца, характер же наследует материнский и начинает проявлять его уже в детстве. Родители Венеры не ладят друг с другом, атмосфера в семье не из лучших, и девочка рано усваивает сложности жизни.

Венера способная девочка, она музыкальна, пластична и спортивна. В школе у нее не было бы проблем, если бы не вечные споры с учителями.

"Зимние" Венеры красивы и женскому обществу предпочитают мужское. У них нелегкий характер и зачастую им не удается найти общий язык даже с собственной матерью.

"Летних" отличает доброта, заботливость и легкое отношение к деньгам, им свойственно бросаться из одной крайности в другую.

Венеры влюбчивы, первый брак у них не всеща удачен, да и вообще они совершают в жизни множество ошибок. Во втором браке счастливы. Они неплохие хозяйки и заботливые матери (чаще дочерей, реже сыновей). Любят одеваться несколько экстравагантно, отдавая предпочтение красным и фиолетовым тонам.

Выбирают профессии: инженера, программиста, модельера, медсестры, бухгалтера, актрисы.

Удача в браке их ждет с тем, кого зовут Борис, Владимир, Виктор, Константин, Денис, Олег, Павел, Глеб, Богдан, Семен или Александр, выбор у Венеры достаточно большой, и не следует его останавливать на мужчине по имени: Леонид, Николай, Станислав, Ефим, Роман, Вадим, Виталий или Анатолий.

Это русское имя , оно имеет то же значение, что и слово "вера".

Вера с детства поражает взрослых своей рассудительностью и меркантильностью. Это всегда уравновешенная девочка, с логическим складом мышления, любительница всяческих копилок и копеечек. Потерянную мамой бусинку всегда можно найти в ее игрушках. Это не шумная, не капризная девочка. Она прилежно учится, не откажется понянчить брата или сестренку, старшие для нее всегда авторитет. Не скандальная, не склочная по натуре, Вера тем не менее редко имеет близких подруг. Не стремится рано выйти замуж.

У Веры хорошо организованный практический ум, сообразительность в конкретных делах, трезвость в оценке происходящего. Вера не лишена творческих способностей, зачастую она музыкальна, но тот, кто увидев ее за роялем, решит, что перед ним находится создание, живущее исключительно духовной жизнью, глубоко ошибается. Вера прекрасно знает, чего она хочет от жизни и никогда не упустит своего. И это качество в ней явно превышает эмоциональное восприятие мира, царит над мечтами и фантазиями.

Вера трезво смотрит на все, ей и в голову не придет, что с милым может быть рай в шалаше. Она считает, что для земного рая нужны вполне реальные вещи. Если эмоции мешают вам подчинить рассудок логике, почаще советуйтесь со знакомой Верой она быстро вернет вас на грешную землю.

Будущего мужа Вера редко выбирает среди сверстников, предпочитает им мужчин постарше. Имеет чаще всего одного ребенка, в котором души не чает, а если этот ребенок девочка, то Вера заранее начинает копить для нее приданое. Детей воспитывает в строгости, сторонница пуританской морали. Вера ладит со свекровью, потому что знает: со свекровью надо ладить. Делает это она мастерски не теряя своего достоинства и удовлетворяя претензии самой придирчивой свекрови. Ее вкусные обеды и накрахмаленные салфетки, заботливое отношение к детям, преданность мужу приводит к тому, что ее начинают любить даже те родственники мужа, которые поначалу были против брака.

Браки, как правило, у Веры удачны. Повезет ей с Вадимом, Александром, Михаилом, Захаром, Егором, Евгением, а вот брак с Олегом, Анатолием, Вячеславом или Владиславом будет скорее всего неудачным.

Вероника библейское имя женщины из Иерусалима, которая, согласно легенде, вытерла пот с лица Иисуса, когда он нес крест.

В детстве робки, застенчивы, нерешительны, подвержены простудным заболеваниям. С возрастом в характере этих чувствительных крошек становятся заметны такие черты, как раздражительность и, особенно, упрямство. Кроме того, у некоторых из них возникает аллергия на запахи, они могут упасть в обморок от вида крови.

Характеру Вероники материнский, хотя внешне она очень похожа на отца. Женскому обществу предпочитает мужское и в браке бывает неоднократно; рождаются у нее обычно девочки. Вероника общительная и живая, мож-но сказать, искрометная женщина и свою живость сохраняет до старости. Она чрезвычайно влюбчива и пользуется ошеломляющим успехом у мужчин. Однако быстро вспыхнувшее чувство может у нее так же быстро улетучится, и тогда она безоговорочно порвет все связи с бывшим возлюбленным. Неприятная черта Вероники упрямство (особенно она характерна для "зимних" Вероник), причем часто она действует просто назло кому-то. Любимые цвета Вероники красный, фиолетовый, черный.

Имени Вероника подходят мужские имена: Владимир, Александр, Петр, Леонид, Станислав, Борис, Игорь это значит, что с носителями таких имен она будет счастлива.

Николай, Эдуард, Виктор, Владислав, Орест, Семен, Виталий, Константин ей мало подходят.

В древнеримской мифологии Веста дочь Сатурна, покровительница домашнего очага.

Стремление командовать всеми и всюду проявляется у этих женщин с детства. Маленькая Веста непременно добивается своего, любой ценой заставит родителей выполнить ее желание, может и истерику закатить в магазине, если ей не купят игрушку. Похожа скорей на отца и привязана к нему больше, чем к матери (интересно, что у "зимней" Весты характер материнский, а у всех остальных отцовский).

"Зимняя" Веста общительна, она любит шумное общество и не переносит одиночества, "летняя", напротив, застенчива, нерешительна и несколько замкнута. Тем не менее у той и другой много друзей, они добры, не завистливы, никогда не откажутся помочь другому. Правда, они немного неловки и, помогая, часто только мешают.

Женщины с таким именем внешне привлекательны и обращают на себя внимание мужчин, одеваются они ярко, броско. Весты не лишены талантов: многие из них неплохо рисуют, танцуют, пишут стихи.

В семье эти женщины верховодят, и мужьям их приходиться мириться с этим обстоятельством. Хозяйки они неплохие, жены внимательны, и матери заботливые. К сожалению, у "осенних" Вест слабые легкие, ранней весной и осенью болезнь дает о себе знать.

Вероятность удачного брака высока, если мужа зовут: Владимиром, Михаилом, Эдуардом, Игорем, Максимом, Андреем, Петром, Станиславом, Виктором, Олегом, Степаном, Наумом или Ярославом (этим девушкам есть из кого выбирать). Многие другие мужчины, такие как Родион, Николай, Гавриил, Донат, Григорий, Леонид, Модест, им не подходят.

БЕТА, ИВЕТТА

Это подвижные и озорные девочки, их слабое здоровье предмет особой заботы родителей. С возрастом благодаря занятиям спортом становятся крепче. Но судьба не балует этих женщин, хотя они и наделены многими способностями. У них неустойчивая нервная система, они слишком восприимчивы и впечатлительны, принимают все близко к сердцу и отчаянные спорщицы. Бета недоверчива, даже мнительна, не доверяет она и собственному мужу, в браке ей приходится нелегко.

Стремление руководить мужем часто заканчивается тем, что брак Беты распадается, и от этого характер ее не становится мягче.

"Зимние" сложные, противоречивые натуры, нелишенные талантов, в том числе и кулинарных.

"Осенние" расчетливы и экономны; предпочитают ходить в гости сами, чем принимать гостей у себя (не любят мыть посуду!). В компании они незаменимы.

"Летние" ранимы, добры и слишком доверчивы, последнее качество часто очень подводит их. Хотя они и домовиты, аккуратны, что называется "домашние" женщины, спутника жизни находят себе с трудом.

Хорошим, надежным мужем Вете может стать Лев, Виталий, Степан, Олег, Иван, Виктор, Александр, Матвей, Захар, Кирилл, Глеб, Сергей. Николай, Анатолий, Борис, Станислав, Ефим не составят ее счастье.

В переводе с латинского: победа.

Виктория часто похожа на отца. Ленива и несколько медлительна. В играх с детьми редко бывает заводилой довольствуется обычно пассивной ролью. Долго не хочет учиться читать, просит родителей почитать ей. Вместе с тем она спокойна, уравновешена, скорее молчунья, чем говорунья, может иногда без видимой для окружающих причины замыкаться в себе. В юности Виктория оживляется, начинает ухаживать за собой, но внутренняя неуверенность, застенчивость остаются жить в ней и часто попытки самоутвердиться проявляют себя в причудливой форме. То юная Виктория сразит окружающих крепким запахом духов, то наденет неприлично короткую юбку. То будет вести себя чрезмерно вызывающе на вечеринке. Эта демонстративность, напористость, выраженные более, чем того требует ситуация, будут характеризовать Викторию и в будущем. На работе она проявляет деловитость, при начальстве даже пытается форсировать события, поучать окружающих, но, получая отпор, мгновенно теряет боевитость и становится такой, какая она есть всегда.

Из всех профессий Виктория выберет ту, что не требует общения с людьми и где конечный результат зависит исключительно от самой Виктории. С удовольствием принимает на себя роль домохозяйки, хотя при соответствующих внешних данных может стать фотомоделью или манекенщицей.

Виктория долго выбирает мужа. Причиной этому является не дурной характер Виктории, как это могут подумать, и не ее высокие требования к будущему мужу, а нерешительность. Она, Виктория, такая всегда, когда речь идет о каком-то решительном шаге в ее жизни. После замужества, сама еще не веря в свершившееся. Виктория продолжает испытывать сомнения по поводу правильности своего шага. Чуткий, внимательный муж поможет обрести ей уверенность в себе, после чего она буквально преобразиться. Станет доверчивой, откровенной, будет безоглядно и сильно любить, жертвовать ради любимого многим. Однако один вероломный поступок мужа и душевное равновесие вновь нарушено. А жаль! Виктория достойна настоящей любви и счастья в браке. Она заботлива и верна.

Наиболее благоприятен брак с Михаилом, Владимиром, Сергеем, Львом, Семеном, Савелием. Наименее с Дмитрием, Альбертом, Виталием, Григорием.

Переводится как "фиалочка" (лат.).

Виолетта смелая и мужественная женщина, эти черты заметны уже в маленькой Виолетте. Она неусидчива, упряма и решительна. Если обидит кого-нибудь, ни за что не попросит прощения, даже если будет понимать, что неправа. Она рано становится самостоятельной.

Взрослая Виолетта эмоциональная, но такая же упрямая и решительная, как и в детстве. Любит утром подольше поспать, работы у нее поздний вечер, она "сова". Старательна, но хорошо делает только то, к чему у нее лежит душа. У нее отменный вкус, она всегда нестандартно одета, фасоны своих туалетов часто придумывает сама.

Виолетты внешне очень привлекательные женщины, мужья не без основания ревнуют их. Они влюбчивы, "летние" Виолетты в браке бывают дважды. Очень общительны, любят шумное общество и всегда в курсе дел своих многочисленных друзей, близких и родных. Предпочитают жить врозь со своими родителями, а тем более со свекровью, отношения с которой складываются не очень приязненными.

"Летние" Виолетты увлекаются симфонической музыкой и питают пристрастие к сладкому. Среди женщин с таким именем есть архитекторы, преподаватели музыки и иностранных языков, инженеры, спортивные тренеры.

Это сильные личности, лидеры, но в жизни им чаще не везет.

Женский вариант мужского имени Виталий: жизненная. Редкое имя, но, дав его дочери, вы подарите ей удивительную судьбу. Мягкость и обаяние женщины дополняет такие качества, как решительность и смелость. Девочка с таким именем любимица подружек и в то же время пользуется авторитетом у окрестных мальчишек. Она очень самостоятельна. Знает, чего хочет, самолюбива, нс учебе уделяет немного внимания. В детские годы любит читать сказки и приключенческие романы.

Взрослея, она как бы изучает всех вокруг себя и пытается увидеть среди окружающих ту, на кого ей хотелось бы быть похожей. Идеала обычно не находит и замыкаете в себе. В этом же возрасте начинаются недоразумения родителями, чаще с мамой.

Виталина обычно рано выходит замуж, но почти никогда ее избранником не станет ровесник. Ее взрослому уму импонирует образованность и умение прочно устроиться в жизни. Выйдя замуж, редко находит общий язык со свекровью. Типичные женские уловки и хитрости, чтобы удержать возле себя мужчину, ей малоинтересны. Да их в ее арсенале, можно сказать, и нет. И не беда! Они с лихвой компенсируются практическим умением владеть ситуацией и подчинять ее своим желаниям. Однако Виталину легко обмануть, в некоторых вопросах она очень доверчива, но не дай Бог узнать ей об обмане. Реакция будет невероятно бурной, а горе безутешным.

Виталина экономная хозяйка, заботится о муже и о детях, однако редко взваливает все домашние хлопоты на себя. Муж Виталины в фартуке, за мытьем посуды обычная картина в доме. Вообще она тяготеет больше к мужским занятиям, и если муж ее деловой человек, то хороший помощник ему гарантирован. В делах она уверена в себе, энергична, решительна. Женщины, носящие имя Виталия или Виталина, комфортнее чувствуют себя в мужской кампании, в женском коллективе играют исключительно роль лидера.

Подпишитесь на новости

Как же часто люди ошибаются при выборе своей второй половинки. А кто-то долгое время посвящает поиску идеального спутника жизни. Решить сердечный вопрос и найти подходящего человека для создания серьезных отношений в наше время очень легко.

На борьбу с несправедливостью судьбы встали астрология, нумерология, хиромантия и другие эзотерические науки, позволяющие заранее узнать любовную совместимость мужчины и женщины. Предлагаем вам определить, подходите ли вы и ваша вторая половинка друг другу по имени. С помощью совместимости имен можно легко выявить будущее любой пары.

Чтобы проверить совместимость имен в любви, вам потребуется взять ручку и листок бумаги в клеточку. Напишите свои полные фамилию, имя и отчество. Каждая буква должна находиться в отдельной клеточке. Под своим именем напишите ФИО своего любимого человека так, чтобы первая буква его фамилии начиналась под первой буквой вашей фамилии, первая буква имени - под первой буквой вашего имени и так далее. Приведем пример с двумя именами:

И В А Н О В А М А Р И Я И Л Ь И Н И Ч Н А
П Е Т Р О В С Т Е П А Н О Л Е Г О В И Ч

Совместимыми имена являются в следующих случаях:

  • Если большинство букв в вертикальном ряду совпадают по принципу гласная-согласная. В приведенных выше именах это, к примеру, первые буквы фамилии (И и П).
  • Если есть совпадения букв в вертикальных рядах (к примеру, О и О).
  • Если количество букв в имени, фамилии и отчестве мужчины и женщины примерно одинаковое (допускается разница не более одной буквы). В приведенном примере фамилия женщины на одну букву больше, чем фамилия мужчины - это говорит о хорошей совместимости в любви.
  • Если фамилии, имена и отчества начинаются с гласных букв или согласных. В данном примере совпадают только буквы имени.
  • Если в ФИО мужчины есть хоть одна буква, которая в большом количестве встречается в ФИО женщины. В приведенном случае, наиболее часто в ФИО женщины встречается буква И. Она присутствует в отчестве мужчины - это хороший знак.

По этим критериям и можно определить любовную совместимость в паре. Если в во всех приведенных параметрах расчета совместимости ФИО в паре совпадают, то этот союз можно считать счастливым и крепким. Но даже одно совпадение указывает на хорошую совместимость.

Если же ни по одному параметру имена не совпали, то это свидетельствует о дисгармонии в паре. Такой союз вполне может быть долгим и крепким, вот только партнеры не будут понимать друг друга, что в конечном счете это приведет либо к расставанию, либо, вполне возможно, к невыносимому браку.

С помощью данной методики расчета совместимости по имени, можно определить и характер отношений. В паре главенствовать будет тот, у кого больше букв в ФИО. Равноправие царит в тех парах, где примерно равное количество гласных букв. Чем меньше гласных букв в ФИО, тем меньший вес в союзе будет иметь человек.

Совместимость по имени позволит вам определить будущее ваших отношений и сделать соответствующие выводы. Конечно, не стоит всецело доверять данному расчету. Помните, что даже самые разные по характеру люди могут счастливо прожить друг с другом не один десяток лет. Вот только судьба их будет постоянно испытывать на прочность и на силу чувств. Партнерам в таких союзах приходится подстраиваться друг под друга и долго искать общий язык. Если же в паре хорошая совместимость, то влюбленным намного легче создать счастливый брак. Их семейному благополучию ничего не сможет помешать. Какой путь выберите вы, решать только вам.

Имя человека определяет многие черты его характера. Поэтому совместимость имен в браке и любви можно определить достаточно точно. Узнайте о наиболее крепких союзах в нашей статье.

Таблица совместимости имен в любви

Приведенная ниже таблица совместимости имен в любви и браке в числовой форме отражает степень взаимопонимания между людьми. В левой части приведены наиболее популярные женские имена, в верхней – мужские. Их пересечение демонстрирует вероятность получить гармоничный союз цифрами от 1 до 9 (1 – очень малая вероятность, 9 – практически 100% успех).

Александр Вадим Денис Даниил Егор Игорь Кирилл Максим Станислав Ярослав
Александра 7 3 5 3 1 6 2 8 6 9
Вероника 9 4 9 5 7 1 1 6 8 5
Дарья 8 6 2 6 5 3 5 7 5 4
Екатерина 4 2 7 4 4 2 4 7 8 9
Жанна 6 6 3 2 5 9 8 4 5 1
Ирина 7 4 3 1 2 9 4 4 6 2
Кристина 2 3 5 5 3 4 3 6 4 3
Лариса 6 7 1 6 4 1 4 6 7 7
Марина 5 9 7 5 4 5 9 8 6 9
Яна 5 4 8 7 2 1 9 9 5 2

Безусловно, любовные отношения зависят от каждого партнера, от взаимопонимания внутри пары и от многих других факторов. Однако и имя влияет на совместимость людей, хоть связь эта и считается весьма относительной.

Из таблицы видно, что суммы баллов у всех имён различны. Причиной тому служат особенности темперамента.

Чаще всего наиболее высокий балл получают девушки с явно выраженной женственной натурой, что демонстрируется в мягкости характера и податливости. Мужчина, являясь охотником по натуре, готов тратить свое время лишь на девушку, которая открыто показывает ответную реакцию на ухаживания. Поэтому умение флиртовать, заложенное именем, способно раскрыть сердце настоящего добытчика.

К именам с сильной женской энергетикой можно отнести следующие: Алёна, Богдана, Василиса, Диана, Елизавета, Милана.

Имя молодого человека также накладывает определенный отпечаток на его судьбу и везение в делах любовных. Упорство, внутренняя сила и уверенность в себе заставляют обратить на мужчину внимание. Сильная мужская энергия присуща именам: Борис, Георгий, Константин, Леонид, Максим, Фёдор.

Стоит отметить, что детальных социологических опросов на данную тему в России не проводилось, поэтому многие данные весьма приблизительны.

Как совместимы имена в браке

Брак – узаконенный добровольный союз, который регистрируется в государственном органе. Поэтому отследить статистику наиболее продолжительных семейных уз не составляет труда.

На текущий 2018 год известен пример пары долгожителей, которые отметили 100-летнюю годовщину совместной жизни. Мужу Нифтуле на тот момент исполнилось 126 лет, а его жене Балбеим – на 10 лет меньше. Это большая редкость, которая, однако, вряд ли основана на одной лишь совместимости имён. Для некоторых партнеров даже с сочетаемыми по всем параметрам именами мирное сосуществование на протяжении даже нескольких лет не представляется возможным.

Как утверждают исследования последних десятилетий, число разводов хоть и падает, но всё равно ещё остается на достаточно высоком уровне. Причин для этого достаточно. Поэтому выбирая партнёра для создания крепкой ячейки общества, стоит внимательнее отнестись к имени избранника.

Энергетика имени влияет на отношение к супругу и браку в целом. Поэтому создание крепкой семьи подразумевает баланс. Например, более упрямые девушки склонны к созданию союзов с менее целеустремленным молодым человеком, и наоборот. При этом оба не чувствуют какого-либо дискомфорта в паре, так как один является движущей силой, второй – надежным тылом, который не подведет.

Исключение составляют пары, где оба партнера представляют одну и ту же крайность.

Люди с высокой степенью неуступчивости, которые нашли друг в друге общие векторы и жизненный смысл, смогут создать крепкий союз. Такие пары с готовностью работают над достижением поставленной задачи, ведь она одинакова у обоих. Целью может быть определенный достаток и его признаки (дом, должность, имущество, уровень жизни) или схожие ценности (дети, творчество). Тогда все упорство партнеры не просто удваивают, но и подпитывая силы друг друга, преумножают в несколько раз. Подобные отношения, однако, достаточно редки, так как совпадение намерений весьма маловероятно.

Гораздо чаще встречаются флегматичные пары. В таких отношениях ни один партнер не готов брать на себя более сильную роль и отвечать за последствия. В результате чего люди выполняют рутинные ежедневные задачи, не имея конкретной цели достичь чего-либо в отношениях. Разрушение таких союзов возможно в случае, когда один из партнеров осознает бесцельность сосуществования. Как показывает практика, чаще об этом задумываются женщины.

Наиболее безынициативные женские имена:
  • Алевтина;
  • Евдокия;
  • Зинаида;
  • Клавдия;
  • Мария.
Флегматичные мужские имена:
  • Глеб;
  • Роман;
  • Сергей;
  • Эдуард.

Совместимые женские и мужские имена для отношений

Совместимость по именам в любви и браке играет важную роль. Но и на крепкие отношения может повлиять имя.

Яркие и интересные союзы основываются на взаимных интересах и увлечениях. Поэтому выигрышную позицию занимают мужчины с более «чуткими» именами и женщины – с более воинственными.

Парень, обладающий высоким уровнем эмпатии (возможность сопереживать), всегда сможет выделиться из толпы сверстников. Такой юноша не станет смеяться или издеваться в сложный момент. Он не только решит проблему девушки, но и посочувствует, пожалеет. Еще одним ценным качеством для создания долгих отношений называют верность. Измена со стороны мужчины в официально не зарегистрированных парах является первой причиной расставания.

Верными и эмпатичными мужскими именами являются:
  • Александр;
  • Виктор;
  • Денис;
  • Илья;
  • Петр.

Сильные девушки чаще привлекают внимание противоположного пола. Поэтому капелька гордости и немного завышенные требования лишь привлекут внимание парней. Общие интересы также смогут повлиять на длительность отношений. Увлечение техникой, тяга к определенной литературе, желание вникнуть в интересы партнера – это характеризует девушку, ориентированную на длительные отношения. Подобные требования выполнимы для юных особ с волевыми чертами имени.

Имена девушек, создающих наиболее крепкие союзы:
  • Александра;
  • Ирина;
  • Ксения;
  • Юлия.

Соединимость в интимном плане

Ни для кого не секрет, что в постели раскрывается все самое сокровенное. И дело даже не в отсутствии одежды, а в деталях поведения, особенностях восприятия друг друга.

Важной характеристикой хорошей совместимости в интимном плане является совпадение темпераментов. Имя накладывает отпечаток даже на эту область человеческой психики.

Мужчина в постели должен выполнять ведущую функцию. Поэтому имя с наиболее ярко выраженными лидерскими качествами является некоторым гарантом здоровой половой жизни. Также немаловажным фактором можно считать уверенность в себе и желание прислушиваться к девушке.

Хорошими любовниками считаются мужчины с именами:
  • Алексей;
  • Вадим;
  • Даниил;
  • Егор;
  • Игорь.

От спутницы жизни в момент интимной близости мужчина ждет страсти и бурной ответной реакции. Поэтому наиболее успешными партнершами являются не просто раскрепощенные девушки, но и прирожденные актрисы.

Имена девушек, являющихся хорошими любовницами:
  • Анастасия;
  • Анна;
  • Вероника;
  • Жанна;
  • Светлана.

Имя накладывает на своего носителя огромное влияние. Оно способно еще при рождении обогатить характер теми или иными качествами. Потому крайне важно понимать совместимость имен для брака и отношений, чтобы в будущем не пополнить печальную статистику разводов.

В любви и браке вызывает множество вопросов у тех, кто хочет построить крепкий союз.

Готовясь к такому важному событию, как свадьба, начинаешь переживать из-за всего, боясь совершить непоправимую ошибку в выборе возлюбленного. И ответы на эти вопросы мы стараемся найти везде: у родственников, знакомых, гадалок или читая гороскопы. Ведь очень важно услышать слова одобрения по поводу выбранного партнера, и поэтому многие обращаются к такой программе, как совместимость имен в браке и любви.

Магия букв

Любое имя, данное при рождении, несет в себе свою энергетику, эзотерический и научно - обоснованный смысл. Оно излучает конкретную вибрацию, которая и определяет в основном дальнейшую судьбу человека. С этим фактом можно спорить, но ученые доказали, что от данного при рождении имени зависит многое, в том числе и влияние на окружающих. Еще в 20 веке знаменитый философ (1882 - 1943 гг.) высказал мысль о том, что существует неразрывная связь между именем человека и происходящими событиями в его жизни.

Способы, которые помогут влюбленным понять подходят ли они друг другу: нумерологический, астрологический и при помощи карт Таро. Также определит совместимость имен в тест.

Влияние имени на совместимость

Насчитывают достаточно способов, которые помогут узнать, насколько влюбленные будут подходить друг другу. Самый простой - это наличие двух и более одинаковых букв в именах обоих партнеров. Однако в этом случае нужно обращать внимание на одно существенное НО: эти буквы не должны означать упрямство, ожесточенность или хамство, так как на этой основе прочных и долгих отношений не получится.

Совместимость имен в любви и браке проверяют также при помощи карт Таро. Для этого из колоды убираются дополнительные карты в колоде. Для козырей существует своя буква, например, для «Мага» — буква «а», «Повешенному» — буква «б», а «Жрице» — буква «е».

Совместимость имен в любви и браке можно вычислить по нумерологии, а именно необходимо высчитать с помощью представленной ниже таблицы обозначение имен партнеров. После этого очень легко выяснить, в какой степени подходят друг другу будущие супруги.

Буквы «а», «и», «с», «ъ» - создающие, направляющие;

Буквы «б», «й», «т», «ы» - отзывчивые, податливые, несамостоятельные;

Буквы «в», «к», «у», «ъ» - общественно значимые;

Буквы «г», «л», «ф», «э» - практичные, приземленные;

Буквы «д», «м», «х», «ю» - подвижные умственно и физически;

Буквы «е», «н», «ц», «я» - общительные, ответственные, надежные;

Буквы «ё», «о», «ч» - разумные, сосредоточенные;

Буквы «ж», «п», «ш» - расчетливые, с раздвоенным сознанием;

Буквы «з», «р», «щ» - чувствительные, многообразные.

После этого можно узнать число своего имени и имени своей второй половинки. У кого оно будет превалировать, тот и будет являться главой в семье, если числа равноправны - это означает, что ожидается гармоничный союз.

На сегодняшний день понять совместимость имен в браке и любви очень легко - во Всемирной паутине находится большое количество онлайн-тестов, которые с точностью определяют, насколько молодые люди подходят друг другу.

Сочетаемость имен по дате рождения

Человек появляется на свет тогда, когда ему положено. Именно дата рождения влияет на дальнейшую жизнь, способствует формированию личностных качеств, характера и темперамента. С помощью чисел также определяется, подходят ли влюбленные один другому. Например: 20.04.1971 = 2+0+0+4+1+9+7+1 = 24 = 2+4 = 6. Таким образом, человеку, рожденному 20.04.1971 г., оказывает влияние на судьбу и привычки число «6».

Сочетаемость влюбленных по знаку гороскопа

В этом случае за основу берут принадлежность партнеров к конкретному знаку зодиака и проводят сравнительный анализ.

Ведь на характер, темперамент, уклад жизни оказывает существенное влияние и принадлежность знака к своей стихии. Это позволяет увидеть более точную картину, насколько будущая семейная пара будет счастлива, будет ли удачным будет их союз как долго они смогут прожить вместе без существенных конфликтов. С помощью совместимости по знаку зодиака можно узнать партнера с разных сторон и научиться принимать его и подстраиваться под него.

Сексуальная сочетаемость

Бывают ситуации, когда человек, которым полностью восхищаешься в повседневной жизни, в постели разочаровывает. И дело не в том, что присутствуют какие-то проблемы со здоровьем, а в том, что два человека просто несовместимы друг с другом в сексуальном плане. Частой причиной расставаний многих пар становится именно эта проблема. Для того чтобы избежать такой неприятной развязки отношений, лучше заранее узнать совместимость имен в любви, сексе и браке.

Напрямую связана с темпераментом и эмоциональностью обоих людей. Эксперты в этой области различают несколько типов сексуального темперамента: слабый, средний и сильный. У тех, у кого сильный тип сексуальности, рано происходит половое созревание. Люди со слабым уровнем сексуальности развиваются гораздо дольше. Но они строят крепкие семьи, брак длится более десяти лет. Представители среднего сексуального типа относятся к категории тех людей, которые не относятся к представителям слабого или сильного типа. Идеальная совместимость по сексуальности предполагает наличие одного типа у партнеров.

Однако не стоит расстраиваться, если предложенные варианты показывают низкую совместимость имен в любви и браке, ведь они не в силах учитывать все факторы, а главное, и чувств друг к другу.

Совместимость имен. Узнайте, насколько подходите друг другу!Узнайте, насколько подходите друг другу! Многие женщины, выходя замуж, терзаются мыслями: а тот ли это человек? Более того, такие опасения могут возникнуть спустя много лет брака. Как не ошибиться при выборе партнера? Оказывается, ответ таится в нумерологии.Каждой букве имени соответствует определенная цифра. Сложите все цифры вашего полного имени (то же самое проделайте с именем партнера) и узнайте про вашу совместимость.

Совместимость имен

Например, возьмем пару Марии и Павла. Мария = 5 + 1 + 9 + 1 + 6 = 22 = 2 + 2 = 4. Павел = 8 + 1 + 3 + 6 + 4 = 22 = 2 + 2 = 4. О совместимости союза можно прочитать ниже.

Результаты совместимости партнеров в браке:

1 и 1 – отношения сложные, так как оба партнера стараются удерживать лидерскую позицию . Пара может быть счастлива в браке, если и муж, и жена будут идти на компромисс.

1 и 2 – партнеры подходят друг другу, как нитка с иголкой. В такой семье царит любовь и гармония.

1 и 3 – бурный союз. Семейные отношения походят на жизнь на пороховой бочке.
1 и 4 – хорошая совместимость. Спустя время партнерам может стать скучно. Спасет общее дело.
1 и 5 – бурные отношения, которые устраивают обоих.

1 и 6 – крепкие отношения, в которых партнеры оказывают друг другу всю необходимую поддержку.

1 и 7 – отношения часто начинаются с привычки, которая со временем перерастает в очень близкие узы.

1 и 8 – в этих отношениях необходимо, чтобы партнеры были на равных. Иначе возможен крах.

1 и 9 – потрясающе гармоничный союз.
2 и 2 – нередки конфликты на почве неумения найти компромисс.

Читайте также:

2 и 3 – один из самых гармоничных союзов. Долгая жизнь вместе и много детей.
2 и 4 – отношения могут быть гармоничными, если партнеры станут более открытыми и искренними.
2 и 5 – счастье в паре возможно, если оба партнера задвинут свое эго.
2 и 6 – партнеры в этом союзе смотрят в одном направлении.
2 и 7 – удачный брак, если отношения начались с дружбы. В дальнейшем узы станут только крепче.
2 и 8 – муж и жена ждут от жизни одного и того же , поэтому их союз гармоничен и долговечен.

2 и 9 – совершенно разные люди, но это не мешает им создать крепкую и счастливую семью.

3 и 3 – если партнеры будут предоставлять друг другу свободу , то союз обречен на успех.

3 и 4 – брак будет долгим , если между партнерами возникнет любовь.

3 и 5 – счастье в браке возможно, если муж и жена будут иметь общие интересы.

3 и 6 – еще один невероятно гармоничный союз.

3 и 7 – партнеры не похожи друг на друга и имеют разные взгляды на жизнь . Однако им удается построить крепкие отношения.

3 и 8 – один из самых неудачных браков, в котором много ссор и недопонимания.

3 и 9 – одинаковые стремления партнеров удерживают их вместе. С годами их отношения только крепнут.

4 и 4 – партнерам в таких отношениях часто бывает скучно.

4 и 5 – разные взгляды на жизнь и отношения в частности не дают этим партнерам построить крепкие и долгосрочные отношения.

4 и 6 – достаточно надежный брак. Во многом благодаря тому, что партнеры имеют одинаковые взгляды на жизнь.

4 и 7 – с самого начала отношений здесь царит постоянство и спокойствие. Одному из партнеров может со временем стать скучно.

4 и 8 – не самый удачный брак. Каждый партнер мечтает лидировать в отношениях.

4 и 9 – высока вероятность счастливого и крепкого брака.

5 и 5 – удачный брак с кучей детишек.

5 и 6 – непредсказуемые отношения. Каждый день в таком браке похож на сюрприз.

5 и 7 – партнеры совершенно не похожи друг на друга, но именно это удерживает их вместе.

5 и 8 – чрезмерная амбициозность одного из партнеров мешает счастью в браке.

5 и 9 – к разладу может привести быт.

Совместимость имен в любви: найди свою половинку

Совместимость знаков имен © shutterstock

Совместимость имен и знаков Зодиака, дат рождения и гороскопов мы всегда пытаемся привлечь на помощь, когда хотим разобраться в своих чувствах к человеку.

Мы никогда не знаем, почему влюбляемся в того, или иного человека. Говорят, любят не за что-то, а вопреки. Но с этим бывает сложно согласиться. Ведь чаще любят просто так, просто потому, что любят. И есть множество теорий, которые причиной любви называют гороскопы, удачное расположение планет или сложную химическую реакцию в организме человека. Верить этому или нет – решает самостоятельно каждый из нас.

Сегодня tochka.net предлагает тебе теорию поиска своего "идеального" человека в любви по гороскопу совместимости по именам. Ведь не зря наши предки придавали имени такое большое значение и не зря есть поговорка: "Как корабль назовешь, так он и поплывет"...

ЧИТАЙ ТАКЖЕ:

Сразу уточним, что, поскольку имен сейчас развелось великое множество, причем самых замысловатых и экзотических, мы выбрали наиболее популярные и привычные для уха варианты. Итак, пройди тест на совместимость имен и узнай, насколько вы подходите друг другу.


Гороскоп совместимости по именам: мужские имена


Совместимость знаков имен © Nicholas Hunt, gettyimages.com

Хорошая совместимость имени Александр с Анной, Валентиной, Варварой, Верой, Вероникой, Дарьей, Елизаветой, Зоей, Инной, Любовью, Людмилой, Марией, Надеждой, Натальей, Оксаной, Полиной, Тамарой.

Сложные отношения с Екатериной, Еленой, Зинаидой, Лидией, Светланой.

Хорошие отношения с Анастасией, Анжелой, Анной, Варварой, Галиной, Клавдией, Ларисой, Любовь, Надеждой, Светланой.

Не так благоприятны отношения с Верой, Оксаной, Тамарой, Юлией.

Хорошие отношения с Марией, Валерией, Галиной, Ириной, Светланой, Ольгой, Татьяной.

Сложности с Екатериной, Еленой, Аллой, Анжелой, Антониной, Мариной, Надеждой, Кларой, Ниной, Полиной, Верой, Юлией.

Хорошая совместимость имени Андрей с Еленой, Елизаветой, Ириной, Клавдией, Ларисой, Людмилой, Марией, Наташей.

Неблагоприятен союз с Варварой, Зоей, Кларой, Оксаной, Ольгой, Софьей, Юлией.

Хорошие отношения с Валерией, Екатериной, Мариной, Ириной.

Хорошие отношения с Анной, Валентиной, Евгенией, Людмилой, Наталией, Оксаной, Олесей, Софьей.

Неблагоприятными отношения с Александрой, Галиной, Ниной, Тамарой, Татьяной.

Хорошие отношения с Анной, Ларисой, Людмилой, Тамарой.

Не очень подходят для серьезных отношений Зоя, Майя, Марина.

Хорошие отношения с Анной, Валентиной, Валерией, Варварой, Вероникой, Зоей, Инной, Ириной, Кларой, Ларисой, Натальей, Ольгой, Светланой, Тамарой.

Неудачными будут отношения с Любовью, Мариной, Надеждой, Ниной, Татьяной, Юлией.

Хорошие отношения с Анжелой, Валентиной, Викторией, Дарьей, Марией, Мариной.

Вызывает сомнение брак с Антониной, Елизаветой, Надеждой, Тамарой.

Хорошие отношения с Зоей, Викторией, Галиной, Надеждой, Олесей, Светланой, Татьяной.

Сложные отношения с Верой, Зинаидой, Ириной, Кларой, Ларисой, Маргаритой, Тамарой.

Хорошие отношения с Маргаритой, Олесей, Юлией, Анной.

Неудачный брак с Лидией, Инной, Екатериной, Любовью, Еленой.

Хорошие отношения с Валентиной, Галиной, Зоей, Инной, Клавдией, Кларой, Ларисой, Любой, Майей, Марией, Ниной, Оксаной, Ольгой.

Трудности с Вероникой, Евгенией, Екатериной, Зинаидой.

Хорошие отношения с Екатериной, Зинаидой, Антониной, Кларой, Лидией, Никой, Марией, Надеждой, Полиной, Тамарой.

Трудности с Зоей, Анастасией, Вероникой, Викторией, Майей, Маргаритой.

Хорошие отношения с Аллой, Анжелой, Валентиной, Зинаидой, Варварой, Вероникой, Евгенией, Инной, Ириной, Любовь, Натальей, Раисой, Светланой, Софьей.

Мало шансов на удачный брак с Майей, Елизаветой, Лидией, Надеждой, Ниной и Еленой.

Хорошие отношения с Галиной, Клавдией, Ириной, Любовью, Софьей, Мариной, Ольгой, Юлией, Тамарой.

Сложности с Анжелой, Зинаидой, Валерией, Маргаритой, Верой, Вероникой, Майей, Наталией, Татьяной, Риммой.

Хорошие отношения с Верой, Вероникой, Клавдией, Полиной, Элеонорой.

Сомнительны отношения с Евгенией, Жанной, Аллой, Мариной, Оксаной, Риммой, Светланой.

Хорошие отношения с Анной, Еленой, Ириной, Ларисой, Маргаритой, Марией, Эльвирой, Юлией.

Трудными будут отношения с Беллой, Зинаидой, Оксаной, Татьяной, Юлией.

Хорошие отношения с Валентиной, Верой, Ириной, Лидией, Любой, Майей, Натальей, Ольгой.

Надо остерегаться брака с Ангелиной, Виолеттой, Оксаной, Риммой, Тамарой, Татьяной.

Хорошие отношения с Варварой, Верой, Галиной, Натальей, Ниной, Светланой.

Трудно ужиться с Викторией, Екатериной, Инной, Лидией, Светланой.

Хорошие отношения с Софьей, Тамарой, Валентиной, Евгенией, Майей, Раисой, Марией.

Будет трудно с Викторией, Екатериной, Инной, Лидией, Светланой.

Хорошо подходят Вера, Алла, Елизавета, Лидия, Оксана, Мария, Тамара, Татьяна.

Непрочный брак с Анжелой, Викторией, Еленой, Ларисой, Наташей.

Хорошие отношения с Анной, Любовью, Людмилой, Ниной, Олесей, Ольгой, Полиной, Тамарой, Татьяной, Эльвирой.

Маловероятны отношения с Елизаветой, Ириной, Ангелиной, Ксенией.

Хорошие отношения с Александрой, Анной, Екатериной, Ларисой, Евгенией, Клавдией, Мариной, Полиной, Софьей.

Непрочным будет союз с Антониной, Зинаидой, Зоей, Инной, Ириной, Ольгой.

Хорошие отношения с Анной, Еленой, Любовью, Людмилой, Наталией, Эльвирой.

Не стоит связывать судьбу с Анжелой, Викторией, Зинаидой, Инной, Ириной, Марией, Ниной, Софьей, Юлией.

Хорошие отношения с Анной, Валентиной, Валерией, Верой, Дарьей, Ксенией, Людмилой, Наталией, Ниной, Раисой, Юлией.

Меньше подходят для брака Варвара, Елена, Зоя, Клавдия, Марина.

Хорошие отношения с Верой, Евгенией, Надеждой, Ниной, Татьяной.

Трудности с Валерией, Варварой, Галиной, Елизаветой, Людмилой, Майей, Полиной.

Хорошие отношения с Анной, Валентиной, Верой, Ириной, Любовь, Надеждой, Наташей, Ольгой, Полиной.

Сложности с Александрой, Дарьей, Инной, Светланой брак может быть неудачен.

Хорошо подходят Алла, Валентина, Дарья, Екатерина, Елизавета, Зоя, Ирина, Клавдия, Мария.

Мало подходит Варвара, Елена, Зинаида, Лариса, Лидия, Майя, Надежда, Римма.

Хорошо подходят Анна, Вера, Наталья, Софья.

Менее подходят для брака Галина, Елизавета, Маргарита, Татьяна.

Хорошие отношения с Аллой, Анжелой, Еленой, Маргаритой, Оксаной, Риммой, Эльвирой.

Не совместим с Валерией, Екатериной, Лидией, Майей, Мариной, Надеждой, Элеонорой.

Хорошие отношения с Анной, Викторией, Евгенией, Инной, Любовью, Полиной, Риммой, Софьей.

Не подойдут для брака Александра, Вероника, Ирина, Клавдия, Мария, Наташа, Ольга.

Хорошие отношения с Анной, Викторией, Ольгой, Ириной, Клавдией, Тамарой, Полиной, Элеонорой.

Скорее всего, ему не подойдут Лидия, Марина, Оксана, Олеся.

Хорошие отношения с Аллой, Анной, Валентиной, Верой, Вероникой, Людмилой, Натальей, Полиной, Элеонорой, Эльвирой, Юлей.

Трудна семейная жизнь с Галиной, Жанной, Инессой, Любовью, Татьяной.

Хорошо подходят Виолетта, Зинаида, Лидия, Маргарита, Нина, Раиса, Светлана, Виктория

Мала вероятность хорошего брака с Антониной, Любовью, Ольгой, Юлией.

Хорошие отношения с Александрой, Варварой, Верой, Дианой, Диной, Еленой, Елизаветой, Кларой, Лидией, Мариной, Ниной, Раисой, Риммой, Тамарой, Эльвирой.

Семейная жизнь может не сложиться с Елизаветой, Оксаной, Ольгой, Софьей.

Хорошо подходят Вера, Алла, Ирина, Клавдия, Людмила, Наталья, Светлана.

Следует остерегаться брака с Анастасией, Анжелой, Валерией, Жанной, Любой, Татьяной.

Хорошие отношения с Анной, Дарьей, Зинаидой, Зоей, Ларисой, Любовью, Эльвирой.

Следует остерегаться брака с Аллой, Валентиной, Вероникой, Галиной, Евгенией, Екатериной, Еленой, Елизаветой, Инной, Людмилой, Мариной, Олесей, Ольгой, Риммой, Юлией.

Хорошие отношения с Антониной, Кларой, Ларисой, Майей, Натальей, Риммой, Светланой, Софьей, Татьяной, Элеонорой.

Неудачным брак может быть с Ангелиной, Варварой, Верой, Дарьей, Екатериной, Елизаветой, Ниной, Ольгой, Оксаной, Мариной

Хорошие отношения с Верой, Диной, Екатериной, Елизаветой, Зинаидой, Майей, Серафимой, Софьей, Эльвирой.

Трудным брак может оказаться с Анжелой, Дарьей, Натальей, Ниной, Татьяной, Юлией.

Подходят Ангелина, Варвара, Вера, Вероника, Диана, Евгения, Екатерина, Лариса, Людмила, Наталья, Светлана.

Неудачный брак может сложиться с Валерией, Диной, Еленой, Зинаидой, Мариной, Оксаной, Татьяной.

Хорошие отношения с Анной, Валентиной, Еленой, Клавдией, Любовью, Майей, Марией, Софьей.

Менее удачными будут отношения с Диной, Евгенией, Екатериной, Оксаной, Риммой, Тамарой.

Хорошие отношения с Ангелиной, Антониной, Валентиной, Валерией, Викторией, Диной, Екатериной, Зоей, Кларой, Майей, Ниной, Оксаной, Ольгой, Раисой, Тамарой.

В жены мало подходят Александра, Анна, Варвара, Вероника, Ирина, Марина, Светлана.

Хорошая совместимость имени Сергей с Валентиной, Викторией, Галиной, Дарьей, Диной, Елизаветой, Ириной, Любовью, Ниной, Риммой, Татьяной.

Сложно будет в браке Аллой, Верой, Ларисой, Элеонорой.

Хорошие отношения с Вероникой, Еленой, Ларисой, Оксаной, Риммой, Тамарой, Элеонорой, Юлией.

Брак будет несчастным с Валентиной, Евгенией, Зинаидой, Мариной, Светланой, Софьей.

Хорошие отношения с Дарьей, Зинаидой, Ириной, Клавдией, Кларой, Лидией, Надеждой, Ольгой.

Трудности ждут с Анной, Еленой, Людмилой, Натальей, Оксаной, Раисой, Риммой.

Хорошие отношения с Анной, Варварой, Клавдией, Лидией, Любовью, Марией, Натальей, Раисой, Светланой.

Сложности возникнут в отношениях с Аллой, Екатериной, Майей, Надеждой, Ниной.

Хорошие отношения с Инной, Ириной, Любовью, Маргаритой, Тамарой.

Вряд ли удачным будет брак с Дарьей, Евгенией, Марией, Надеждой, Раисой.

Хорошие отношения с Лидией, Риммой, Светланой, Юлией.

Сложной будет семейная жизнь с Дарьей, Дианой, Клавдией, Ларисой, Людмилой, Майей, Марией.

Хорошие отношения с Анжелой, Антониной, Галиной, Дарьей, Зинаидой, Ларисой, Лидией, Любовью, Натальей, Ольгой, Полиной, Раисой, Светланой, Софьей, Тамарой.

Мала вероятность удачного брака с Аллой, Вероникой, Елизаветой, Зоей, Татьяной.

Хорошие отношения с Галиной, Инной, Клавдией, Людмилой, Полиной, Тамарой.

Сложными отношения будут с Диной, Екатериной, Людмилой, Раисой.


Гороскоп совместимости по именам: женские имена


Бывает ли совместимость имен по дате рождения? © Instagram

Хорошие отношения с Александром, Виктором, Евгением, Михаилом, Петром, Владимиром, Яковом.

Мало подходят Дмитрий, Игорь, Алексей, Николай, Анатолий.

Хорошие отношения с Владимиром, Иваном, Ильей, Кириллом, Никитой, Сергеем, Эдуардом.

Менее удачными будут отношения с Дмитрием, Захаром, Максимом, Романом, Филиппом.

Хорошие отношения с Борисом, Владимиром, Виктором, Константином, Денисом, Олегом, Павлом, Семеном.

Сложнее отношения будут складываться с Вадимом, Виталием, Николаем, Станиславом, Филиппом.

Хорошие отношения с Борисом, Виктором, Владимиром, Игорем, Петром, Семеном, Эдуардом.

Трудно будет ужиться с Геннадием, Олегом, Станиславом, Степаном, Анатолием.

Хорошие отношения с Владимиром, Виктором, Валентином, Иваном, Максимом, Петром.

Скорее всего, брак будет неудачным с Игорем, Дмитрием, Анатолием, Владиславом, Эдуардом.

Хорошие отношения с Алексеем, Борисом, Евгением, Захаром, Константином, Степаном.

Неудачные отношения сложатся с Александром, Георгием, Сергеем, Львом, Станиславом.

Хорошо подходят Виталий, Олег, Сергей, Семен, Юрий.

Неудачным брак будет с Иваном, Игорем, Константином, Никитой, Федором.

Хорошо подходят Александр, Валентин, Виктор, Михаил, Максим, Яков.

Менее подходят мужчины с именами Николай, Игорь, Роман, Семен, Эдуард.

Хорошие отношения с Валентином, Владимиром, Глебом, Иваном, Сергеем, Семеном, Александром.

Непростыми отношения будут с Борисом, Георгием, Леонидом, Николаем, Станиславом, Юрием.

Хорошо подходят Анатолий, Борис, Антон, Илья, Никита.

Ей придется трудно с Вениамином, Кириллом, Петром, Владиславом.

Хорошо подходят Александр, Алексей, Борис, Владимир, Георгий, Михаил, Петр, Федор.

Меньше подходят Андрей, Олег, Семен, Иван, Егор, Евгений.

Хорошие отношения с Александром, Вадимом, Егором, Евгением, Захаром, Михаилом, Павлом, Яковом.

Лучше воздержаться от брака с Анатолием, Вячеславом, Владиславом, Олегом, Филиппом.

Хорошие отношения с Александром, Борисом, Владимиром, Игорем, Леонидом, Петром, Станиславом.

Мало ей подходят Виктор, Владислав, Виталий, Константин, Николай, Семен, Эдуард.

Хорошие отношения с Владимиром, Михаилом, Львом, Сергеем, Семеном, Эдуардом.

Отношения, скорее всего не сложатся с Александром, Виталием, Дмитрием, Григорием, Юрием.

Хорошие отношения с Алексеем, Валерием, Виктором, Георгием, Павлом, Станиславом, Яковом.

Неудачно с Егором, Кириллом, Леонидом, Николаем, Романом.

Хорошие отношения с Александром, Антоном, Иваном, Евгением, Сергеем, Юрием.

Жизнь может не сложиться в браке с Олегом, Семеном, Федором, Филиппом, Алексеем.

Хорошие отношения с Борисом, Андреем, Михаилом, Петром, Романом, Станиславом.

Сложными будут отношения с Владиславом, Глебом, Даниилом, Константином, Львом, Олегом.

Хорошие отношения с Антоном, Виталием, Денисом, Петром, Павлом, Семеном.

Неудачно с Виктором, Кириллом, Николаем, Филиппом, Яковом.

Хорошие отношения с Андреем, Дмитрием, Игорем, Захаром, Константином, Романом, Станиславом.

Неудачно могут сложиться брачные отношения с Анатолием, Василием, Иваном, Степаном.

Хорошие отношения с Александром, Иваном, Михаилом, Никитой, Эдуардом.

Маловероятен удачный брак с Валентином, Николаем, Олегом, Станиславом.

Хорошие отношения с Артёмом, Вадимом, Дмитрием, Максимом.

Не сложатся отношения с Афанасием, Борисом, Олегом, Семеном.

Хорошо подходят Александр, Борис, Валерий, Виктор, Иван, Семен.

Следует остеречься замужества с Виталием, Евгением, Ильей, Кириллом, Юрием.

Хорошие отношения с Александром, Владимиром, Константином, Петром, Яковом.

Менее удачным может получиться брак с Вадимом, Василием, Иваном, Николаем, Романом.

Хорошие отношения с Андреем, Борисом, Иваном, Леонидом, Сергеем, Степаном, Игорем

Меньше повезет с Валерием, Дмитрием, Константином, Романом.

Хорошие отношения с Алексеем, Андреем, Виктором, Романом, Федором.

Неудачно отношения в браке могут сложиться с Константином, Никитой, Сергеем, Юрием.

Хорошие отношения с Борисом, Виктором, Михаилом, Олегом, Семеном, Степаном.

Менее удачным будет брак с Анатолием, Валерием, Денисом, Станиславом.

Хорошие отношения с Аркадием, Георгием, Максимом, Юрием.

Лучше воздержаться от брака с Григорием, Иваном, Эдуардом.

Хорошие отношения с Алексеем, Максимом, Михаилом, Сергеем, Эдуардом.

Маловероятен счастливый брак с Василием, Глебом, Львом, Иваном, Кириллом.

Хорошие отношения с Алексеем, Александром, Виктором, Геннадием, Глебом, Константином, Юрием.

Маловероятен удачный брак с Борисом, Игорем, Станиславом.

Хорошие отношения с Александром, Андреем, Дмитрием, Евгением, Кириллом, Ильей.

Следует быть осторожней с Егором, Николаем, Степаном, Эдуардом.

Хорошие отношения с Виктором, Вадимом, Денисом, Павлом, Степаном.

Лучше воздержаться от отношений с Владиславом, Егором, Никитой, Фёдором, Эдуардом.

Хорошие отношения с Анатолием, Александром, Виктором, Григорием, Валентином, Евгением, Иваном.

Сложными отношения будут с Борисом, Вячеславом, Кириллом, Эдуардом.

Хорошие отношения с Антоном, Валентином, Владимиром, Денисом, Михаилом, Сергеем.

Неудачен брак, скорее всего, будет с Анатолием, Борисом, Георгием, Николаем, Станиславом.

Хорошие отношения с Александром, Виталием, Егором, Константином, Юрием.

Неудачным будет брак, скорее всего с Анатолием, Владимиром, Иваном, Федором.

Хорошие отношения с Александром, Андреем, Борисом, Владимиром, Олегом, Юрием.

Неудачными отношения в браке могут быть с Владиславом, Григорием, Захаром, Никитой, Степаном.

Хорошие отношения с Валентином, Виктором, Георгием, Михаилом, Семеном, Сергеем.

Большие сложности в семейной жизни будут с Анатолием, Дмитрием, Иваном, Фёдором.

Хорошие отношения с Аркадием, Валерием, Василием, Игорем, Филиппом, Яковом.

Менее подходит для брака Артем, Николай, Станислав, Федор.

Хорошие отношения с Анатолием, Виктором, Владиславом, Захаром, Львом, Семеном, Степаном.

Менее вероятно счастье с Денисом, Игорем, Константином, Николаем.

Хорошие отношения с Александром, Виталием, Денисом, Константином, Юрием.

Могут быть неудачными отношения с Анатолием, Вадимом, Игорем, Станиславом, Филиппом.

Хорошие отношения с Владимиром, Глебом, Евгением, Михаилом, Сергеем, Федором, Юрием.

Брак будет непрочным с Игорем, Степаном, Яковом.

Хорошие отношения с Вадимом, Владимиром, Олегом, Эдуардом, Юрием, Алексеем, Борисом.

Возможны серьезные осложнения в браке с Александром, Глебом, Дмитрием, Михаилом, Станиславом.

Хорошие отношения с Анатолием, Валерием, Иваном, Олегом, Сергеем.

Маловероятен удачный брак с Вячеславом, Геннадием, Кириллом, Станиславом, Филиппом.

Хорошие отношения с Антоном, Игорем, Михаилом, Петром, Семеном.

Меньше всего шансов с Анатолием, Владимиром, Николаем, Львом.

Хорошие отношения с Александром, Борисом, Виктором, Евгением, Сергеем.

Неудачным может стать брак с Олегом, Павлом, Петром, Семеном.

Хорошая совместимость имени Юлия с Василием, Владиславом, Евгением, Кириллом, Эдуардом.

Под вопросом отношения в браке с Анатолием, Андреем, Николаем, Фёдором, Филиппом.

ЧИТАЙ ТАКЖЕ:

Напомним, ранее мы публиковали любовный гороскоп на 2018 год для всех знаков Зодиака. Подробнее читай по ссылке.

Все самые яркие и интересные новости смотри на главной странице женского онлайн-ресурса tochka.net

Подписывайся на наш Facebook и будь в курсе всех самых интересных и актуальных новостей!

Совместимость имен. Какие женщины и мужчины подходят друг другу

Совместимость имен. Какие женщины и мужчины подходят друг другу. Фото: pexels.com

Подходят ли друг другу Анна и Андрей? Какого предпочесть Светлане  – Владимира или Максима?

Наши предки давно заметили, что между обладателями определенных имен существует невидимая связь. Как они звучат отдельно и насколько гармонируют друг с другом, попытался выяснить сайт cheltv.ru.

АннаФото: pexels.com

Анна любит много и упорно работать. Имеет много друзей и легко заводит новые знакомства. Благодаря трудолюбию успешно продвигается по карьерной лестнице. Ей предстоит немало разочарований в жизни из-за высоких требований, которые она предъявляет не только к себе, но и к окружающим.

Анна обладает привлекательной внешностью, артистична. Мужа выбирает сердцем, но с ней редко рядом оказывается самостоятельный и самодостаточный мужчина. Анна выполняет роль «матери», поэтому ей необходим спокойный спутник жизни, о котором необходимо заботиться.

Удачный союз: Сергей, Юрий, Артем, Александр.

ВикторияФото: pexels.com

Виктория обладает аналитическим складом ума, а потому в жизни склонна опираться на факты и логику. Самостоятельна, ответственна, плохо работает в команде и предпочитает возглавлять процесс.

Не любит пустых слов, а потому не будет ждать «принца на белом коне». Очень ревнива и не переносит неверность близкого человека. Ее требования к мужчинам достаточно высоки. В то же время Виктория является прекрасной хозяйкой и заботливой матерью.  

Удачный союз: Евгений, Николай, Виктор, Денис.  

Екатерина Совместимость имен. Какие женщины и мужчины подходят друг другу. Фото: pexels.com

Екатерина –  открытый человек, однако эгоистична. Легка в общении, исполнительна и неконфликтна, так как умеет сглаживать острые углы.

В любви бросается в крайности, а потом выходит замуж по расчету. Ей необходим комфорт, а не «рай в шалаше». Знает себе цену, а потому способна за себя постоять. С более сильным партнером становится мягкой, покладистой.

Удачный союз: Андрей, Кирилл, Роман, Валентин.  

Марина Совместимость имен. Какие женщины и мужчины подходят друг другу. Фото: pexels.com

Марина – женщина, которая не может жить без любви. Чувственная и ранимая натура, она всегда в центре внимания, любит лесть и похвалу. И сама умеет обольщать, однако романы ее недолговечны.

Предпочитает сильных, мужественных мужчин, которые превосходят ее в интеллектуальном плане. Семье Марина уделяет много времени. Замужеством дорожит. Ее дом выглядит как с картинки, а дети любимы и ухожены.  

Удачный союз: Никита, Аркадий, Григорий, Павел.  

Светлана Совместимость имен. Какие женщины и мужчины подходят друг другу. Фото: pexels.com

Светлану отличают обаяние, женственность, мягкий и покладистый характер. Она сексуальна и притягательна для мужчин. Но в то же время эта женщина как будто соткана из противоречий. В слабости ее сила: Светлана получает все, чего захочет, однако опирается на интуицию, так как стратег из нее плохой.   

Спутника жизни ищет долго, для нее важны надежность партнера и его материальное состояние. Из нее получается идеальная мать и прекрасная хозяйка.

 

Удачный союз: Борис, Владимир, Максим, Константин.  

Совместимость имен. Какие женщины и мужчины подходят друг другу

Фен-шуй: пожиратели счастья или 7 предметов, которые нельзя хранить дома

Совместимость имен

Конечно, мы не выбираем себе вторую половину по имени — это было бы по меньшей мере странно. И вообще, в любви, в отличие от математики, нет никаких правил, кроме, наверное, моральных. И это хорошо, потому что предсказуемость/механика и чувства — вещи несовместимые. С другой стороны, все мы во что-то верим, и чем сильней, тем больше эта вера на нас влияет. Это касается и имен. Для кого-то это просто некий набор звуков, а кто-то, будучи склонным к метафизике, слышит в именах нечто значительное. Итак, есть ли какая-то магия в именах, априори связывающая одно с другим? Звезды утверждают, что да, есть.

Алина, Юлия, Елизавета, Яна, Анжела, Светлана

Носители этих имен отличаются непростым характером, они крайне эмоциональны и того же ищут в партнерах. Сдержанные мужчины заставят их скучать, зато те, у кого не сердце, а пламенный мотор, увлекут за собой. Причем куда угодно. Счастье этим девушкам принесут Александр, Владислав, Вячеслав, Дмитрий, Илья, Леонид, Руслан, Станислав. 

Пусть весь мир подождет: 6 правил здорового эгоизма Читать

Алла, Анна, Яна, Жанна 

Эти женщины способны глубоко чувствовать и сопереживать, они принципиальны в своей любви, преданны, но очень независимы. Вот им-то как раз и требуется сдержанный, нордический мужской тип. Антон, Вадим, Виктор, Анатолий, Владимир, Игорь, Константин, Павел, Роман, Алексей смогут погасить напор такой женщины и дать ей уверенность в том, что она действительно любима и очень важна.

Вера, Екатерина, Надежда

Все эмоции — внутри. Снаружи — логика, сдержанность, вежливость и дистанция. Но это не холодность, нет: все эти качества сопровождаются жизнелюбием, уместным оптимизмом и интересом к людям. Мужчин они выбирают тщательно, но все-таки сердцем. Ум — это потом, сначала любовь, та, настоящая. У носительниц этих имен не должно быть проблем с партнером, если тот, конечно, сам не нарывается. Однако больше всего вероятность счастья с Алексеем, Борисом, Валерием, Владимиром, Игорем, Дмитрием, Михаилом, Николаем, Русланом, Станиславом, Филиппом.

Ксения, Анастасия, Софья, Анфиса

Эмоции через край, резкость без границ. Это женщины, которые живут на полную катушку и не допускают никаких компромиссов и полумер. Любить так любить, ненавидеть так... Брр. Лучше до этого не доводить. И лучше не бить по их самолюбию, потому что рикошетом может прилететь так, что мало не покажется. Слишком гордые и себялюбивые мужчины — Петр, Михаил — сильно рискуют. Зато корректные, но знающие себе цену Максим, Артем, Антон, Борис, Вадим, Виктор, Владимир, Всеволод, Игорь, Константин, Никита, Роман, Сергей будут ко двору и сердцу.

Ирина, Кира, Виктория, Нина

Карьера и личная жизнь — две стороны одной медали, и обладательницы этих имен стараются соблюдать баланс, не отдавая предпочтение чему-то одному. Иногда у них это получается, но чаще всего нет. Рассчитывать на себя, придумывать цель, считая себя реалисткой, а на деле находясь в плену иллюзий, — да, это обычная история. Что до мужчин, эти женщины не хотят никого завоевывать и подчинять, но и себя в этом смысле «сломать» не дадут. Им нужен кто-то равный (по крайней мере, они так считают). Оптимальные кандидаты — Владимир, Георгий, Виктор, Герман, Евгений, Сергей.

Валентина, Галина, Елена, Евгения

Как и Ксения, Анастасия, Анфиса и Софья, эти женщины — из категории независимых, стремительных и резких. Но. Они очень, очень хотят — пусть и глубоко в душе — тихого семейного счастья и неспешности во всем. Есть ли среди мужчин те, кто рискнет стреножить их? Есть. И тут нужен не только строгий нрав и характер, но и огромное терпение. Этого полно, как правило, у Егора, Игоря, Кирилла, Петра, Якова.

Наталья, Ольга, Татьяна, Дарья

Резкая смена настроения, определенная капризность, нежелание идти на компромисс могут обернуться жуткими скандалами на уровне военных конфликтов с мужчинами, которых зовут Юрий, Алексей, Дмитрий. Все потому, что эти мужчины — сами по себе, не терпят шума, напора и не любят договариваться. Однако решение проблемы имеется. Точней, решения. Зовут этих смельчаков Андрей, Анатолий, Антон, Владимир, Виктор, Егор, Игорь, Никита, Олег, Роман, Сергей. Пожелаем парням удачи и терпения, конечно.

Марина, Мария, Маргарита, Тамара, Любовь, Людмила

Чувственные женщины, знающие, как они умеют влиять на мужчин, и пользующиеся этим, но в меру. При этом счастье им может дать мужчина, который видит их насквозь, не идет на поводу, но искренне любит. Мы говорим об амбициозных, но понимающих Борисе, Владимире, Дмитрии, Кирилле, Юрии.

Читайте также: Лучшая половина жизни: мужья по знаку зодиака

Лучшие материалы InStyle в нашем канале на Яндекс.Дзен

Совместимость по имени - Калькулятор семейной совместимости

День рождения найдет все совместимость с этим в нумерологии раздела брака. Проконсультируйтесь в разделе нумерология. Из Европы, Азии, Африки или Америки совместимые имена рождаются как люди. Чтобы узнать больше о происхождении вашего имени, найдите имя, модные имена по странам, а также их этимологию и калькулятор их значения для различных значений в разделе: Происхождение имен в браке.

Нумерология в астрологии

Проконсультируйтесь с названием раздела. Совместимость даты и нумерологии, мы предлагаем ежедневно гороскоп, персонализированный для вашего имени соответствия. Любовь, деньги, форма: узнайте, что ждет вас сегодня совместимостью. В Нумерологии каждый день находите свою ежедневную счастливую фигуру .. Гороскоп первых имен. Вот любовный гороскоп имени: Аурелиано. Брак: будьте готовы к оживленному обсуждению имени. Прогулка и свежий воздух пойдут на пользу миру.Одиночные игры: еще один день совместимости, который вы проведете в одиночестве. Сделайте это совместимостью, нумерологией: брак не может длиться вечно. Ваши финансовые планы могут обернуться чем-то конкретным, Аурелиано. Вы чувствуете себя как имя хорошего в жизни. Тогда совместимость, побалуйте себя - только один раз! Ваша счастливая совместимость:. Начало Дата имен Совместимость имен Имя гороскопа, имя и нумерология. Совместимость имен, проверьте, совместимы ли имена! Подходите к нашему тесту, узнайте теперь, что подходит вам.Проверьте любовь, если ваша дата рождения совместима! Этот счетчик любви поможет вам на дне рождения. Нумерология - это простой день рождения любви, который отображает любовные свидания на основе имен. Калькулятор расчета любви калькулятор любви - это луна по определенному алгоритму. После ввода двух имен этот калькулятор сопоставляет имя с нумерологией от первого лица, некоторые параметры любви, имени и брака. Алгоритм любовного калькулятора любовь обнаруживает луну, многие параметры совместимости имеют общий брак.

Другие игры

На основе этого анализа калькулятор приходит к выводу и проценту совместимости имени Луны.Твое имя. Имя партнера. Подсказки проверяют родство имен. нажмите, чтобы увидеть больше возрастных романов - Советы для старости при рождении.

Советы по знакомствам. Впечатляет и на первом свидании. Что заставляет вас влюбиться? Женись на нем. Мифы о браке и романтике.

Что вызывает любовь и влечение?

Фэн Мун, твоя любовь. Чтение из прошлой жизни. Найдите свой камень рождения. Любовный гороскоп. В супружеской жизни мы часто получаем совместимые дни рождения многих людей и начинаем с ними отношения, но через несколько дней мы обнаруживаем, что нумерология брака не рассчитывается друг с другом.

Итак, калькулятор нумерологии классического любовного имени родители посоветовались бы с нумерологией гороскопов датировать луну уровнем совместимости отношениями браком. Но современные калькуляторы игнорируют сопоставление совпадений и очень быстро вступают в родственные отношения. Совместимость современности там называются разными типами и тестами. Некоторые из них являются нумерологическим тестом на совместимость, а некоторые консультируются с тестом датировки имени и даты.

Другие игры

Вы когда-нибудь задумывались, как это имя и работают вместе, чтобы выяснить совместимость Луны? Имя Совместимость Имя По нумерологии Какое влияние наш день рождения может повлиять на отношения, которые мы можем иметь с другими? Как работает калькулятор любви?

Связаться с нумерологией Пожертвовать сейчас! Подписка на электронные новости Войти.Все права защищены. Влюбленность - это самый феноменальный брак, который когда-либо испытывал человек. Это действительно другое чувство, которое можно выразить только словами.

Это объясняет, почему многие люди на свидании пытались определить любовь своими словами и способами, но их попытки рождения не привели к успешным результатам. Матч тестовых успешных методов оценки любовной совместимости двух влюбленных - это нумерология имени. Заполните имена в калькуляторе ниже и найдите свою пару со своим партнером :.Восприятие - это очень яркое понятие, которое индивидуально для каждого человека, живущего на этой планете. Независимо от этого, имя любви заставляет одного затуманивать девятку.

Если вы любите кого-то, то вы определенно хотите провести с этим человеком всю свою жизнь. Но прежде чем нумерология перейдет к отношениям совместимости имени при рождении к другой совместимости, очень важно рассмотреть самый важный фактор, определяющий любовную жизнь на свидании. Нумерологические отношения процветают, если в них присутствует совместимость.Футуристические цели рождения также удовлетворительно достигаются, если вы проводите свою жизнь с замужним человеком.

Цены на выбросы углерода, переход технологий и развитие на основе навыков

Автор

Включено в список:
  • Борисов Кирилл
  • Браусманн, Александра
  • Бретчгер, Лукас

Abstract

Мы анализируем влияние цен на углерод на накопление человеческого капитала, отраслевые изменения и экономический рост.В нашей структуре результаты производятся с использованием грязных и / или чистых технологий с использованием квалифицированного и неквалифицированного труда в качестве ресурсов. Углеродная политика влияет на выбор технологий, которые стимулируют формирование человеческого капитала. Мы показываем, что временной политики может быть достаточно для перехода к чистой экономике и что такая политика также стимулирует экономический рост. Более того, при наличии распространения знаний между странами углеродная политика на Севере способствует формированию человеческого капитала на Юге и способствует переходу Юга к чистому устойчивому состоянию.

Рекомендуемое цитирование

  • Борисов, Кирилл и Браусманн, Александра и Бретчгер, Лукас, 2019. « Цены на выбросы углерода, переход технологий и развитие на основе навыков », Европейский экономический обзор, Elsevier, vol. 118 (C), страницы 252-269.
  • Обозначение: RePEc: eee: eecrev: v: 118: y: 2019: i: c: p: 252-269
    DOI: 10.1016 / j.euroecorev.2019.05.011

    Скачать полный текст от издателя

    Поскольку доступ к этому документу ограничен, вы можете поискать другую версию ниже или найти другую версию.

    Другие версии этого продукта:

    • Кирилл Борисов, Лукас Бретчгер и Александра Виноградова, 2018. « Ценообразование за выбросы углерода, переход технологий и развитие на основе навыков », Серия рабочих документов CER-ETH по экономике 18/285, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
    • Кирилл Борисов и Лукас Бретчгер, 2018. « Ценообразование за выбросы углерода, переход технологий и развитие на основе навыков », Серия рабочих документов CER-ETH по экономике 18/297, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.

    Ссылки на IDEAS

    1. Родольфо Э. Мануэли и Анант Сешадри, 2014 г. « Человеческий капитал и богатство народов », Американский экономический обзор, Американская экономическая ассоциация, т. 104 (9), страницы 2736-2762, сентябрь.
    2. Консоли, Давиде и Марин, Джованни и Марзукки, Альберто и Вона, Франческо, 2016. « Отличаются ли« зеленые »рабочие места от« незеленых »с точки зрения навыков и человеческого капитала? », Политика исследований, Elsevier, vol.45 (5), страницы 1046-1060.
    3. Дарон Асемоглу, Филипп Агион, Леонардо Бурштин и Дэвид Хемус, 2012 г. « Окружающая среда и направленные технические изменения », Американский экономический обзор, Американская экономическая ассоциация, т. 102 (1), страницы 131-166, февраль.
      • Дарон Асемоглу и Филипп Агион, Леонардо Бурштин и Дэвид Хемус, 2009 г. « Окружающая среда и направленные технические изменения », Рабочие документы NBER 15451, Национальное бюро экономических исследований, Inc.
      • Acemoglu, Daron & Aghion, Philippe & Bursztyn, Leonardo & Hemous, David, 2011. « Окружающая среда и направленные технические изменения », Документы для обсуждения CEPR 8660, C.E.P.R. Документы для обсуждения.
      • Acemoglu, Daron & Aghion, Philippe & Bursztyn, Leonardo & Hemous, David, 2010. « Окружающая среда и направленные технические изменения », Материалы семинара 762, Стокгольмский университет, Институт международных экономических исследований.
      • Acemoglu, Daron & Aghion, Philippe & Bursztyn, Leonardo & Hemous, David, 2010.« Окружающая среда и направленные технические изменения », Документы по устойчивому развитию 92839, Фонд Эни Энрико Маттеи (FEEM).
      • Дарон Асемоглу и Филипп Агион, Леонардо Бурштын и Дэвид Хемус, 2010 г. « Окружающая среда и направленные технические изменения », Рабочие бумаги 2010.93, Фонд Эни Энрико Маттеи.
    4. Рейер Герлаг и Матти Лиски, 2018. « Цены на углерод на следующие сто лет », Экономический журнал, Королевское экономическое общество, т.128 (609), страницы 728-757, март.
    5. Стефан Амбек и Марк А. Коэн, Стюарт Элджи и Пол Ланой, 2013. « Гипотеза Портера, 20 лет: может ли экологическое регулирование способствовать инновациям и конкурентоспособности? », Обзор экономики и политики окружающей среды, Ассоциация экономистов-экологов и специалистов по ресурсам, т. 7 (1), страницы 2-22, январь.
      • Амбек, Стефан и Коэн, Марк А. и Элджи, Стюарт и Ланой, Пол, 2010. « Гипотеза Портера, 20 лет: может ли экологическое регулирование способствовать инновациям и конкурентоспособности? », Рабочие документы IDEI 655, Institut d'Economie Industrielle (IDEI), Тулуза.
      • Амбек, Стефан и Коэн, Марк А. и Элджи, Стюарт и Ланой, Пол, 2010. « Гипотеза Портера, 20 лет: может ли экологическое регулирование способствовать инновациям и конкурентоспособности? », Рабочие документы TSE 10-215, Тулузская школа экономики (TSE).
      • Амбек, Стефан и Коэн, Марк А. и Элджи, Стюарт и Ланой, Пол, 2011. « Гипотеза Портера, 20 лет: может ли экологическое регулирование способствовать инновациям и конкурентоспособности? », Документы для обсуждения dp-11-01, Ресурсы на будущее.
      • Стефан АМБЕК и Марк А. КОЭН, Стюарт ЭЛДЖИ и Пол ЛАНУИ, 2010 г. « Гипотеза Портера на 20 лет: может ли экологическое регулирование способствовать инновациям и конкурентоспособности? », Cahiers de recherche 10-02, HEC Montréal, Institut d'économie appliquée.
      • Амбек, Стефан и Коэн, Марк и Элджи, Стюарт и Ланой, Пол, 2010. « Гипотеза Портера, 20 лет: может ли экологическое регулирование способствовать инновациям и конкурентоспособности? », Рабочие документы LERNA 10.14.320, ЛЕРНА, Тулузский университет.
      • Стефан Амбек и Марк А. Коэн и Стюарт Элджи и Пол Ланой, 2010 г. « Гипотеза Портера, 20 лет: может ли экологическое регулирование способствовать инновациям и конкурентоспособности? », Рабочие документы CIRANO 2010-е-29, CIRANO.
    6. Лукас Бретчгер, 2017. « Справедливость и конвергенция определяемых на национальном уровне климатических политик », Исследования в области экономики и политики окружающей среды, Springer; Общество исследований в области экономики и политики окружающей среды - SEEPS, vol.19 (1), страницы 1-14, январь.
    7. Smulders, Sjak & de Nooij, Michiel, 2003. « Влияние энергосбережения на технологии и экономический рост », Экономика ресурсов и энергетики, Elsevier, vol. 25 (1), страницы 59-79, февраль.
    8. Bosi Stefano & Ragot Lionel, 2013. « Об оптимальном контроле загрязнения в модели роста человеческого капитала », Письма по математической экономике, De Gruyter, vol. 1 (1), страницы 9-15, октябрь.
    9. Филипп Агион и Антуан Дешезлепретр, Давид Хемус, Ральф Мартин и Джон Ван Ринен, 2016 г.« Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Журнал политической экономии, University of Chicago Press, vol. 124 (1), страницы 1-51.
      • Агион, Филипп и Дечезлепретр, Антуан и Хемус, Давид и Мартин, Ральф и Ван Ринен, Джон, 2012. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Интернет-документы LSE Research по экономике 48936, Лондонская школа экономики и политических наук, Библиотека Лондонской школы экономики.
      • Филипп Агион и Антуан Дешезлепретр, Давид Хемус и Ральф Мартин и Джон Ван Ринен, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Рабочие бумаги 2012.99, Фонд Эни Энрико Маттеи.
      • Филипп Агион и Антуан Дешезлепретр, Давид Хемус и Ральф Мартин и Джон Ван Ринен, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Рабочие документы NBER 18596, Национальное бюро экономических исследований, Inc.
      • Филипп Агион и Антуан Дешезлепретр, Давид Хемус и Ральф Мартин и Джон ван Ринен, 2016 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », PSE-Ecole d'économie de Paris (Постпринт) halshs-01496920, HAL.
      • Агион, Филипп и Дечезлепретр, Антуан и Хемус, Давид и Мартин, Ральф и Ван Ринен, Джон, 2016. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Интернет-документы LSE Research по экономике 62722, Лондонская школа экономики и политических наук, Библиотека Лондонской школы экономики.
      • Агион, Филипп и Дечезлепретр, Антуан и Хемус, Давид и Мартин, Ральф и Ван Ринен, Джон, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Документы для обсуждения CEPR 9267, C.E.P.R. Документы для обсуждения.
      • Агион, Филипп и Дечезлепретр, Антуан и Хемус, Давид и Мартин, Ральф и Ван Ринен, Джон, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Изменение климата и устойчивое развитие 143129, Фонд Эни Энрико Маттеи (FEEM).
      • Филипп Агион и Антуан Дешезлепретр, Давид Хемус и Ральф Мартин и Джон ван Ринен, 2016 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Пост-печать halshs-01496920, HAL.
      • Агион, Филипп и Дечезлепретр, Антуан и Хемус, Давид и Мартин, Ральф и Ван Ринен, Джон, 2016. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Научные статьи 27759048, факультет экономики Гарвардского университета.
      • Филипп Агион и Антуан Дешезлепретр, Давид Хемус и Ральф Мартин и Джон Ван Ринен, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Документы для обсуждения КООС dp1178, Центр экономических показателей, Лондонская фондовая биржа.
      • Филипп Агион и Антуан Дечезлепретр, Давид Хемус и Ральф Мартин и Джон Ван Ринен, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Рабочие документы GRI 102, Исследовательский институт Grantham по изменению климата и окружающей среде.
    10. Стерн Николай, 2015. « Почему мы ждем? Логика, срочность и перспективы решения проблемы изменения климата », Книги MIT Press, MIT Press, выпуск 1, том 1, номер 0262029189, сентябрь.
    11. Бретчгер, Лукас, 2015. « Цены на энергоносители, рост и промежуточные каналы: теория и доказательства », Экономика ресурсов и энергетики, Elsevier, vol. 39 (C), страницы 29-52.
      • Лукас Бретчгер, 2006 г. « Цены на энергию, рост и промежуточные каналы: теория и доказательства », Серия рабочих документов CER-ETH по экономике 06/47, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
      • Лукас Бретчгер, 2010 г. « Цены на энергию, рост и промежуточные каналы: теория и доказательства », Рабочие документы OxCarre 034, Оксфордский центр анализа экономик, богатых природными ресурсами, Оксфордский университет.
    12. Франческо Вона, Джованни Марин, Давиде Консоли и Дэвид Попп, 2018. « Регулирование окружающей среды и экологические навыки: эмпирическое исследование », Журнал Ассоциации экономистов-экологов и специалистов по ресурсам, University of Chicago Press, vol.5 (4), страницы 713-753.
      • Франческо Вона, Джованни Марин, Давиде Консоли и Дэвид Попп, 2015. « Зеленые навыки ,» Рабочие бумаги 2015.72, Фонд Эни Энрико Маттеи.
      • Франческо Вона и Джованни Марин, Давиде Консоли и Дэвид Попп, 2018. « Экологическое регулирование и экологические навыки: эмпирическое исследование », Публикации Sciences Po информация: hdl: 2441 / 1fkb59dcsg9, Sciences Po.
      • Франческо Вона, Джованни Марин, Давиде Консоли и Дэвид Попп, 2015 г.« Зеленые навыки ,» Серия рабочих документов CESifo 5323, CESifo.
      • Франческо Вона, Джованни Марин, Давиде Консоли и Дэвид Попп, 2015 г. « Зеленые навыки ,» Рабочие документы NBER 21116, Национальное бюро экономических исследований, Inc.
      • Давиде Консоли и Джованни Марин, Дэвид Попп и Франческо Вона, 2015 г. « Зеленые навыки ,» Публикации Sciences Po 21116, Sciences Po.
    13. Давид де ла Круа и Маттиас Дупке, 2003 г.« Неравенство и рост: почему важна разница в рождаемости », Американский экономический обзор, Американская экономическая ассоциация, т. 93 (4), страницы 1091-1113, сентябрь.
      • ДЕ ЛА КРУА, David & DOEPKE, Matthias, 2001. « Неравенство и рост: почему важна разница в рождаемости », Документы для обсуждения LIDAM IRES 2001008, Католический университет Лувена, Институт экономических и социальных исследований (IRES).
      • ДЕ ЛА КРУА, David & DOEPKE, Matthias, 2003.« Неравенство и рост: почему важна разница в рождаемости », LIDAM перепечатывает CORE 1676 г., Католический университет Лувена, Центр исследований операций и эконометрики (CORE).
      • Давид де ла Круа и Маттиас Дупке, 2001. « Неравенство и рост: почему важна разница в рождаемости », Рабочие документы UCLA по экономике 803, Департамент экономики Калифорнийского университета в Лос-Анджелесе.
    14. Лукас Бретчгер и Александра Виноградова, 2018. « Спасение от дамоклова меча: эндогенные климатические потрясения в растущей экономике », Серия рабочих документов CER-ETH по экономике 18/291, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
    15. Бретчгер, Лукас и Суфафифат, Нуджин, 2014. « Эффективная климатическая политика в динамической модели Север-Юг », Европейский экономический обзор, Elsevier, vol. 69 (C), страницы 59-77.
    16. Ланс Бовенберг, А. и де Моой, Рууд А., 1997. « Реформа экологического налогообложения и эндогенный рост », Журнал общественной экономики, Elsevier, vol. 63 (2), страницы 207-237, январь.
      • Бовенберг А.Л. и де Моуй Р.А., 1994. « Реформа экологического налогообложения и эндогенный рост », Другие публикации TiSEM 2553aace-59b1-4ef6-b62a-9, Тилбургский университет, Школа экономики и менеджмента.
      • Бовенберг А.Л. и де Моуй Р.А., 1994. « Реформа экологического налогообложения и эндогенный рост », Документ для обсуждения 1994-98, Тилбургский университет, Центр экономических исследований.
      • Бовенберг А.Л. и де Моуй Р.А., 1997. « Реформы экологического налогообложения и эндогенный рост », Другие публикации TiSEM 87a3194a-0d1c-4e5b-83df-6, Тилбургский университет, Школа экономики и менеджмента.
    17. Ланс Бовенберг, A. & Smulders, Sjak, 1995.« Качество окружающей среды и технологические изменения, увеличивающие загрязнение в двухсекторной модели эндогенного роста », Журнал общественной экономики, Elsevier, vol. 57 (3), страницы 369-391, июль.
    18. Риччи, Франческо, 2007. « Каналы передачи экологической политики на экономический рост: обзор теории », Экологическая экономика, Elsevier, vol. 60 (4), страницы 688-699, февраль.
    19. Мартин Л. Вайцман, 2014 г. « Может ли согласование единой цены на углерод помочь интернализировать внешние эффекты глобального потепления? », Журнал Ассоциации экономистов-экологов и специалистов по ресурсам, University of Chicago Press, vol.1 (1), страницы 29-49.
    20. Мелисса Делл и Бенджамин Ф. Джонс и Бенджамин А. Олкен, 2012 г. « Температурные шоки и экономический рост: данные за последние полвека », Американский экономический журнал: Макроэкономика, Американская экономическая ассоциация, т. 4 (3), страницы 66-95, июль.
    21. Джошуа Графф Зивин и Мэтью Нейделл, 2012 г. « Влияние загрязнения на производительность труда ,» Американский экономический обзор, Американская экономическая ассоциация, т. 102 (7), страницы 3652-3673, декабрь.
    22. Филипп Агион и Антуан Дешезлепретр, Давид Хемус, Ральф Мартин и Джон Ван Ринен, 2016 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Журнал политической экономии, University of Chicago Press, vol. 124 (1), страницы 1-51.
      • Филипп Агион и Антуан Дечезлепретр, Дэвид Хемус и Ральф Мартин и Джон Ван Ринен, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Рабочие документы GRI 102, Исследовательский институт Grantham по изменению климата и окружающей среде.
      • Агион, Филипп и Дечезлепретр, Антуан и Хемус, Давид и Мартин, Ральф и Ван Ринен, Джон, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Интернет-документы LSE Research по экономике 48936, Лондонская школа экономики и политических наук, Библиотека Лондонской школы экономики.
      • Филипп Агион и Антуан Дешезлепретр, Давид Хемус и Ральф Мартин и Джон Ван Ринен, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Рабочие документы NBER 18596, Национальное бюро экономических исследований, Inc.
      • Филипп Агион и Антуан Дешезлепретр, Давид Хемус и Ральф Мартин и Джон ван Ринен, 2016 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », PSE-Ecole d'économie de Paris (Постпринт) halshs-01496920, HAL.
      • Агион, Филипп и Дечезлепретр, Антуан и Хемус, Давид и Мартин, Ральф и Ван Ринен, Джон, 2016. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Интернет-документы LSE Research по экономике 62722, Лондонская школа экономики и политических наук, Библиотека Лондонской школы экономики.
      • Агион, Филипп и Дечезлепретр, Антуан и Хемус, Давид и Мартин, Ральф и Ван Ринен, Джон, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Документы для обсуждения CEPR 9267, C.E.P.R. Документы для обсуждения.
      • Агион, Филипп и Дечезлепретр, Антуан и Хемус, Давид и Мартин, Ральф и Ван Ринен, Джон, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Изменение климата и устойчивое развитие 143129, Фонд Эни Энрико Маттеи (FEEM).
      • Филипп Агион и Антуан Дешезлепретр, Давид Хемус и Ральф Мартин и Джон ван Ринен, 2016 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Пост-печать halshs-01496920, HAL.
      • Филипп Агион и Антуан Дешезлепретр, Давид Хемус и Ральф Мартин и Джон Ван Ринен, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Документы для обсуждения КООС dp1178, Центр экономических показателей, Лондонская фондовая биржа.
      • Агион, Филипп и Дечезлепретр, Антуан и Хемус, Давид и Мартин, Ральф и Ван Ринен, Джон, 2016. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Научные статьи 27759048, факультет экономики Гарвардского университета.
      • Филипп Агион и Антуан Дешезлепретр, Давид Хемус и Ральф Мартин и Джон Ван Ринен, 2012 г. « Налоги на выбросы углерода, зависимость от маршрута и направленные технические изменения: данные из автомобильной промышленности », Рабочие бумаги 2012 г.99, Фонд Эни Энрико Маттеи.
    23. Гломм, Герхард и Равикумар, Б., 1992. « Государственные и частные инвестиции в эндогенный рост человеческого капитала и неравенство доходов », Журнал политической экономии, University of Chicago Press, vol. 100 (4), страницы 818-834, август.
    24. Бенджамин Ф. Джонс, 2014. « Человеческий капитал: обобщенный подход », Американский экономический обзор, Американская экономическая ассоциация, т. 104 (11), страницы 3752-3777, ноябрь.
    25. Фрэнк Хеттих, 1998. « Эффект роста от реформы экологического налогообложения без учета доходов », Журнал экономики, Springer, vol. 67 (3), страницы 287-316, октябрь.
    26. Джошуа Графф Зивин и Мэтью Нейделл, 2013 г. « Окружающая среда, здоровье и человеческий капитал ,» Журнал экономической литературы, Американская экономическая ассоциация, т. 51 (3), страницы 689-730, сентябрь.
    27. Михаил Голосов, Джон Хасслер, Пер Крузелл и Олег Цывинский, 2014.« Оптимальные налоги на ископаемое топливо в общем равновесии », Econometrica, Econometric Society, vol. 82 (1), страницы 41-88, январь.
      • Голосов, Михаил и Хасслер, Джон и Крузелл, Пер и Цывински, Олег, 2011. « Оптимальные налоги на ископаемое топливо в общем равновесии », Документы для обсуждения CEPR 8527, C.E.P.R. Документы для обсуждения.
      • Михаил Голосов, Джон Хасслер, Пер Крузелл и Олег Цывинский, 2011. « Оптимальные налоги на ископаемое топливо в общем равновесии », Рабочие документы NBER 17348, Национальное бюро экономических исследований, Inc.
    28. Онур Сапчи и Джейсон Ф. Шогрен, 2018. « Качество окружающей среды, человеческий капитал и рост ,» Журнал экономики и политики окружающей среды, Taylor & Francis Journals, vol. 7 (2), страницы 184-203, апрель.
    29. Филипп Мишель и Жиль Ротийон, 1995. « Бесполезность загрязнения и эндогенного роста ,» Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т. 6 (3), страницы 279-300, октябрь.
    30. Всемирный банк, 2012 г. « Инклюзивный зеленый рост: путь к устойчивому развитию », Публикации Всемирного банка, Всемирный банк, номер 6058, июнь.
    31. Франческо Вона, Джованни Марин, Давиде Консоли и Дэвид Попп, 2015 г. « Зеленые навыки ,» Рабочие бумаги 2015.72, Фонд Эни Энрико Маттеи.
      • Вона, Франческо и Марин, Джованни и Консоли, Давиде и Попп, Дэвид, 2015. « Зеленые навыки ,» Изменение климата и устойчивое развитие 207360, Фонд Эни Энрико Маттеи (FEEM).
      • Франческо Вона, Джованни Марин, Давиде Консоли и Дэвид Попп, 2015 г. « Зеленые навыки ,» Рабочие документы NBER 21116, Национальное бюро экономических исследований, Inc.
      • Давиде Консоли и Джованни Марин, Дэвид Попп и Франческо Вона, 2015 г. « Зеленые навыки ,» Публикации Sciences Po 21116, Sciences Po.
      • Франческо Вона, Джованни Марин, Давиде Консоли и Дэвид Попп, 2015 г. « Зеленые навыки ,» Серия рабочих документов CESifo 5323, CESifo.
    32. Кристиан Голлиер и Жан Тироль, 2015 г. « Ведение переговоров эффективных институтов против изменения климата », Экономика энергетики и экологическая политика, Международная ассоциация экономики энергетики, т. 0 (номер 2).
    33. Лукас Бретчгер и Александра Виноградова, 2017. " Человеческое развитие в опасности: экономический рост с вызванными загрязнением окружающей средой потрясениями для здоровья ", Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т.66 (3), страницы 481-495, март.
    34. Лукас Роберт-младший, 1988. « О механике экономического развития » Журнал монетарной экономики, Elsevier, vol. 22 (1), страницы 3-42, июль.
    Полные ссылки (включая те, которые не соответствуют элементам в IDEAS)

    Цитаты

    Цитаты извлекаются проектом CitEc, подпишитесь на его RSS-канал для этого элемента.


    Цитируется по:

    1. Ara Jo, 2020. « Эластичность замены чистой и грязной энергии с технологическим уклоном », Серия рабочих документов CER-ETH по экономике 20/344, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
    2. Шан, Тяньчэн и Ян, Лань и Лю, Пейхонг и Шан, Кайти и Чжан, Ян, 2020. « Режим финансирования проектов заключения контрактов на энергоэффективность с потенциалом сокращения выбросов углерода и рейтингом выбросов углерода », Энергетическая политика, Elsevier, vol. 144 (С).
    3. Флориан Бёзер и Кьяра Колесанти Сенни, 2020. « Процентные ставки на основе выбросов и переход к низкоуглеродной экономике », Серия рабочих документов CER-ETH по экономике 20/337, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
    4. Лукас Бретчгер и Карен Питтель, 2020. « Двадцать ключевых проблем в области экономики окружающей среды и природных ресурсов », Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т. 77 (4), страницы 725-750, декабрь.
    5. Лукас Бретчгер и Карен Питтель, 2019. « Двадцать ключевых вопросов экономики окружающей среды и ресурсов », Серия рабочих документов CER-ETH по экономике 19/328, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.

    Самые популярные товары

    Это элементы, которые чаще всего цитируют те же работы, что и эта, и цитируются в тех же работах, что и эта.
    1. Карло Карраро, Энрика Де Сиан и Массимо Тавони, 2012 г. « Человеческий капитал, инновации и климатическая политика: комплексная оценка », Рабочие бумаги 2012. 18, Фонд Эни Энрико Маттеи.
      • Карраро, Карло и Де Сиан, Энрика и Тавони, Массимо, 2012 г. « Человеческий капитал, инновации и климатическая политика: комплексная оценка », Изменение климата и устойчивое развитие 122861, Фонд Эни Энрико Маттеи (FEEM).
      • Карраро, Карло и Де Сиан, Энрика и Тавони, Массимо, 2012 г. « Человеческий капитал, инновации и климатическая политика: комплексная оценка », Документы для обсуждения CEPR 8919, C.E.P.R. Документы для обсуждения.
    2. Оуэслати, Валид, 2015. « Влияние реформы экологического налогообложения и политики государственных расходов на рост и благосостояние », Экономическое моделирование, Elsevier, vol. 45 (C), страницы 1-13.
    3. Лукас Бретчгер и Эймилия Паттаку, 2019.« Как бы плохо ни было: как функции, наносящие ущерб климату, влияют на экономический рост и социальные издержки углерода », Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т. 72 (1), страницы 5–26, январь.
    4. Филиппо Бонтадини и Франческо Вона, 2020. « Анатомия зеленой специализации: данные о производстве в ЕС, 1995-2015 гг. », Публикации Sciences Po 21, наук ПО.
    5. Риччи, Франческо, 2007. « Каналы передачи экологической политики на экономический рост: обзор теории », Экологическая экономика, Elsevier, vol.60 (4), страницы 688-699, февраль.
    6. Хему, Дэвид, 2016. « Динамическое воздействие односторонней экологической политики », Журнал международной экономики, Elsevier, vol. 103 (C), страницы 80-95.
    7. Dechezlepretre, Antoine & Martin, Ralf & Mohnen, Myra, 2014. « Распространение знаний из чистых и грязных технологий », Интернет-документы LSE Research по экономике 60501, Лондонская школа экономики и политических наук, Библиотека Лондонской школы экономики.
    8. Sjak Smulders, Michael Toman и Cees Withagen, 2014 г.«Теория роста и« Зеленый рост »», Рабочие документы OxCarre 135, Оксфордский центр анализа экономик, богатых природными ресурсами, Оксфордский университет.
    9. Фабрици, Андреа и Гуарини, Джулио и Мелициани, Валентина, 2018. « Зеленые патенты, нормативная политика и политика исследовательской сети », Политика исследований, Elsevier, vol. 47 (6), страницы 1018-1031.
    10. Лукас Бретчгер, 2016. « Совместима ли окружающая среда с ростом? Принятие интегрированной платформы », Серия рабочих документов CER-ETH по экономике 16/260, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
    11. Карло Карраро и Энрика Де Чиан и Массимо Тавони, 2009 г. « Формирование человеческого капитала и смягчение последствий глобального потепления: данные комплексной модели оценки », Серия рабочих документов CESifo 2874, CESifo.
    12. Десмет, Клаус и Росси-Хансберг, Эстебан, 2015. « О пространственном экономическом воздействии глобального потепления ,» Журнал экономики города, Elsevier, vol. 88 (C), страницы 16-37.
      • Клаус Десмет и Эстебан Росси-Хансберг, 2012 г.« О пространственно-экономических последствиях глобального потепления », Рабочие документы NBER 18546, Национальное бюро экономических исследований, Inc.
      • Клаус ДЕСМЕТ и Эстебан Росси-Хансберг, 2013. « О пространственно-экономических последствиях глобального потепления », Документы для обсуждения 13057, Научно-исследовательский институт экономики, торговли и промышленности (НИИЭТИ).
      • Десмет, Клаус и Росси-Хансберг, Эстебан, 2012 г. « О пространственно-экономических последствиях глобального потепления », Документы для обсуждения CEPR 9220, г.E.P.R. Документы для обсуждения.
    13. Леннокс, Джеймс А. и Витаевски-Балтвилкс, январь 2017 г. « Направленные технические изменения с использованием технологий, воплощенных в капитале: последствия для климатической политики », Экономика энергетики, Elsevier, vol. 67 (C), страницы 400-409.
    14. Хассан, Махмуд и Уэслати, Валид и Руссельер, Дэмиен, 2020. « Экологические налоги, реформы и экономический рост: эмпирический анализ панельных данных », Экономические системы, Elsevier, т.44 (3).
    15. Андреас Шефер, 2017. « Защита прав интеллектуальной собственности, борьба с загрязнением и направленное техническое изменение », Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т. 66 (3), страницы 457-480, март.
    16. Хироаки Сакамото, Масако Икефудзи и Ян Р. Магнус, 2020 г. « Адаптация для смягчения последствий », Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т.75 (3), страницы 457-484, март.
      • Масако Икефудзи, Ян Магнус и Хироаки Сакамото, 2014 г. « Адаптация для смягчения последствий », Документы для обсуждения в Институте Тинбергена 14-126 / III, Институт Тинбергена.
      • Икефудзи, Масако и Магнус, Ян Р. и Сакамото, Хироаки, 2014. « Адаптация для смягчения последствий », Изменение климата и устойчивое развитие 1
      • , Фонд Эни Энрико Маттеи (FEEM).
      • Масако Икефудзи и Ян Р. Магнус и Хироаки Сакамото, 2014 г.« Адаптация для смягчения последствий », Рабочие бумаги 2014. 102, Фонд Эни Энрико Маттеи.
      • Хироаки Сакамото, Масако Икефудзи и Ян Р. Магнус, 2017. « Адаптация для смягчения последствий ,» Документы для обсуждения e-16-014, Высшая школа экономики, Киотский университет.
    17. Wu, Tao & Zhang, Ning & Gui, Lin & Wu, Wenjie, 2018. « Модель устойчивого эндогенного роста для нескольких регионов: согласование операционной деятельности и экономических перспектив », Европейский журнал операционных исследований, Elsevier, vol.269 ​​(1), страницы 218-226.
    18. Франческо Риччи, 2007 г. « Экологическая политика и рост, когда вводимые ресурсы дифференцируются по интенсивности загрязнения », Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т. 38 (3), страницы 285-310, ноябрь.
    19. Кэролайн Фишер и Гарт Хойтель, 2013 г. « Экологическая макроэкономика: экологическая политика, бизнес-циклы и направленные технические изменения », Annual Review of Resource Economics, Annual Reviews, vol.5 (1), страницы 197-210, июнь.
      • Garth Heutel и Кэролайн Фишер, 2013 г. « Экологическая макроэкономика: экологическая политика, бизнес-циклы и направленные технические изменения », Рабочие документы NBER 18794, Национальное бюро экономических исследований, Inc.
      • Fischer, Carolyn & Heutel, Гарт, 2013 г. « Экологическая макроэкономика: экологическая политика, бизнес-циклы и направленные технические изменения », Рабочие документы UNCG по экономике 13-2, Университет Северной Каролины в Гринсборо, факультет экономики.
    20. Серый, Феликс, 2018. « Корпоративное лоббирование защиты окружающей среды », Журнал экономики и менеджмента окружающей среды, Elsevier, vol. 90 (C), страницы 23-40.
      • Феликс Грей, 2017. « Корпоративное лоббирование защиты окружающей среды », Рабочие бумаги EPRG 1714, Группа исследования энергетической политики, Кембриджская школа бизнеса Джадж, Кембриджский университет.
      • Грей, Ф., 2017. « Корпоративное лоббирование защиты окружающей среды », Кембриджские рабочие документы по экономике 1732 г., экономический факультет Кембриджского университета.

    Подробнее об этом продукте

    Ключевые слова

    Цены на углерод; Образование; Чистые и грязные технологии; Временные полисы;
    Все эти ключевые слова.

    Классификация JEL:

    • Q43 - Экономика сельского хозяйства и природных ресурсов; Окружающая среда и экологическая экономика - - Энергия - - - Энергия и макроэкономика
    • O47 - Экономическое развитие, инновации, технологические изменения и рост - - Экономический рост и совокупная производительность - - - Эмпирические исследования экономического роста; Совокупная производительность; Конвергенция результатов по странам
    • Q56 - Экономика сельского хозяйства и природных ресурсов; Экологическая и экологическая экономика - - Экологическая экономика - - - Окружающая среда и развитие; Окружающая среда и торговля; Устойчивость; Экологические счета и бухгалтерский учет; Экологическая справедливость; Прирост населения
    • O41 - Экономическое развитие, инновации, технологические изменения и рост - - Экономический рост и совокупная производительность - - - Одно-, двух- и многосекторные модели роста

    Статистика

    Доступ и загрузка статистики

    Исправления

    Все материалы на этом сайте предоставлены соответствующими издателями и авторами.Вы можете помочь исправить ошибки и упущения. При запросе исправления укажите дескриптор этого элемента: RePEc: eee: eecrev: v: 118: y: 2019: i: c: p: 252-269 . См. Общую информацию о том, как исправить материал в RePEc.

    По техническим вопросам, касающимся этого элемента, или для исправления его авторов, названия, аннотации, библиографической информации или информации для загрузки, обращайтесь: (Nithya Sathishkumar). Общие контактные данные провайдера: http://www.elsevier.com/locate/eer .

    Если вы создали этот элемент и еще не зарегистрированы в RePEc, мы рекомендуем вам сделать это здесь.Это позволяет связать ваш профиль с этим элементом. Это также позволяет вам принимать потенциальные ссылки на этот элемент, в отношении которого мы не уверены.

    Если CitEc распознал ссылку, но не связал с ней элемент в RePEc, вы можете помочь с этой формой .

    Если вам известно об отсутствующих элементах, цитирующих этот элемент, вы можете помочь нам создать эти ссылки, добавив соответствующие ссылки таким же образом, как указано выше, для каждого ссылочного элемента. Если вы являетесь зарегистрированным автором этого элемента, вы также можете проверить вкладку «Цитаты» в своем профиле RePEc Author Service, поскольку там могут быть некоторые цитаты, ожидающие подтверждения.

    Обратите внимание, что исправления могут занять пару недель, чтобы отфильтровать различные сервисы RePEc.

    Совместима ли окружающая среда с ростом? Внедрение интегрированной платформы

    Автор

    Abstract

    В статье разрабатывается интегрированная базовая модель для оценки компромиссов между природной средой и экономическим ростом. Рост потребления рассматривается с точки зрения благосостояния и устойчивости. В этой схеме накопление капитала и отраслевая структура экономики являются ключевыми элементами, позволяющими справиться с нехваткой ресурсов и загрязнением окружающей среды.Представлены расширения модели, изменяющие количество секторов и затрат, изменяющие центральные функциональные формы и вводящие плохое замещение затрат и рост населения. Эта установка подчеркивает двойную роль используемых вводимых ресурсов как источника экологических проблем и как часть решения; также обсуждаются эффекты неопределенности и импульса. В документе делается вывод о том, что окружающая среда и экономический рост могут быть совместимы, но небольшие отклонения от оптимального пути влекут за собой неустойчивое развитие.Критическими проблемами для устойчивости являются недостаточная дальновидность, возрастающая интенсивность ущерба и неоптимальная политика, в то время как рост населения и плохое замещение факторов производства не обязательно опасны для будущего развития.

    Рекомендуемое цитирование

  • Лукас Бретчгер, 2016. « Совместима ли окружающая среда с ростом? Принятие интегрированной платформы », Серия рабочих документов CER-ETH по экономике 16/260, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
  • Дескриптор: RePEc: eth: wpswif: 16-260

    Скачать полный текст от издателя

    Ссылки на IDEAS

    1. Дарон Асемоглу, Филипп Агион, Леонардо Бурштин и Дэвид Хемус, 2012 г. « Окружающая среда и направленные технические изменения », Американский экономический обзор, Американская экономическая ассоциация, т. 102 (1), страницы 131-166, февраль.
      • Дарон Асемоглу и Филипп Агион, Леонардо Бурштин и Дэвид Хемус, 2009 г.« Окружающая среда и направленные технические изменения », Рабочие документы NBER 15451, Национальное бюро экономических исследований, Inc.
      • Acemoglu, Daron & Aghion, Philippe & Bursztyn, Leonardo & Hemous, David, 2011. « Окружающая среда и направленные технические изменения », Документы для обсуждения CEPR 8660, C.E.P.R. Документы для обсуждения.
      • Acemoglu, Daron & Aghion, Philippe & Bursztyn, Leonardo & Hemous, David, 2010. « Окружающая среда и направленные технические изменения », Материалы семинара 762, Стокгольмский университет, Институт международных экономических исследований.
      • Acemoglu, Daron & Aghion, Philippe & Bursztyn, Leonardo & Hemous, David, 2010. « Окружающая среда и направленные технические изменения », Документы по устойчивому развитию 92839, Фонд Эни Энрико Маттеи (FEEM).
      • Дарон Асемоглу и Филипп Агион, Леонардо Бурштын и Дэвид Хемус, 2010 г. « Окружающая среда и направленные технические изменения », Рабочие бумаги 2010.93, Фонд Эни Энрико Маттеи.
    2. Бовенберг, A Lans & Smulders, Sjak A, 1996.« Переходные воздействия экологической политики в модели эндогенного роста », Международное экономическое обозрение, Департамент экономики, Пенсильванский университет и Институт социальных и экономических исследований Университета Осаки, т. 37 (4), страницы 861-893, ноябрь.
      • Бовенберг, А.Л. и Смолдерс, Дж. А., 1994. « Переходное влияние экологической политики на модель эндогенного роста », Документ для обсуждения 1994-50, Тилбургский университет, Центр экономических исследований.
      • Бовенберг, А.Л. и Смолдерс, Дж. А., 1996. « Влияние экологической политики на переходный период в модели эндогенного роста », Другие публикации TiSEM e002b2ed-f04f-4ffc-98f8-0, Тилбургский университет, Школа экономики и менеджмента.
    3. Smulders, Sjak & de Nooij, Michiel, 2003. « Влияние энергосбережения на технологии и экономический рост », Экономика ресурсов и энергетики, Elsevier, vol. 25 (1), страницы 59-79, февраль.
    4. Asheim, Geir B. & Buchholz, Wolfgang & Tungodden, Bertil, 2001. « Обоснование устойчивости », Журнал экономики и менеджмента окружающей среды, Elsevier, vol. 41 (3), страницы 252-268, май.
      • Asheim, G.B. И Бухгольц, В. И Тунгодден Б., 1999. « Обоснование устойчивости ,» Меморандум 08/1999, Университет Осло, факультет экономики.
      • Asheim, G.B. И Бухгольц, В. и Тунгодден, Б., 1999. « Обоснование устойчивости », Статьи 5/99, Норвежская школа экономики и делового администрирования.
    5. Стерн Николай, 2007. « Экономика изменения климата ,» Кембриджские книги, Издательство Кембриджского университета, номер 9780521700801.
    6. Фредерик Плоег и Сис Витхаген, 2014 г. «Рост , возобновляемые источники энергии и оптимальный налог на выбросы углерода », Международное экономическое обозрение, Департамент экономики, Пенсильванский университет и Институт социальных и экономических исследований Университета Осаки, т. 55, страницы 283-311, февраль.
    7. Ланс Бовенберг, А.И Смолдерс, Сяк, 1995. « Качество окружающей среды и технологические изменения, увеличивающие загрязнение в двухсекторной модели эндогенного роста », Журнал общественной экономики, Elsevier, vol. 57 (3), страницы 369-391, июль.
    8. Эдвард Барбье, 1999. « Эндогенный рост и нехватка природных ресурсов ,» Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т. 14 (1), страницы 51-74, июль.
    9. Мартин Л. Вайцман, 2014 г.« Может ли согласование единой цены на углерод помочь интернализировать внешние эффекты глобального потепления? », Журнал Ассоциации экономистов-экологов и специалистов по ресурсам, University of Chicago Press, vol. 1 (1), страницы 29-49.
    10. Дерек Лемуан и Кристиан Трэгер, 2014 г. « Следите за своим шагом: оптимальная политика в нестабильном климате », Американский экономический журнал: экономическая политика, Американская экономическая ассоциация, т. 6 (1), страницы 137-166, февраль.
    11. Лукас Бретчгер, 2013 г.« Рост населения и нехватка природных ресурсов: долгосрочное развитие в, казалось бы, неблагоприятных условиях », Скандинавский журнал экономики, Wiley Blackwell, vol. 115 (3), страницы 722-755, июль.
    12. Бретчгер, Лукас и Шефер, Андреас, 2017. « Грязная история против чистых ожиданий: может ли энергетическая политика дать импульс для роста? », Европейский экономический обзор, Elsevier, vol. 99 (C), страницы 170-190.
    13. Бретчгер, Лукас, 1998. « Как заменить, чтобы поддержать: рост, обусловленный знаниями в условиях экологических ограничений », Окружающая среда и экономика развития, Cambridge University Press, vol.3 (4), страницы 425-442, октябрь.
    14. Бретчгер, Лукас, 2015. « Цены на энергоносители, рост и промежуточные каналы: теория и доказательства », Экономика ресурсов и энергетики, Elsevier, vol. 39 (C), страницы 29-52.
      • Лукас Бретчгер, 2006 г. « Цены на энергию, рост и промежуточные каналы: теория и доказательства », Серия рабочих документов CER-ETH по экономике 06/47, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
      • Лукас Бретчгер, 2010 г.« Цены на энергию, рост и промежуточные каналы: теория и доказательства », Рабочие документы OxCarre 034, Оксфордский центр анализа экономик, богатых природными ресурсами, Оксфордский университет.
    15. Карен Питтель и Лукас Бретчгер, 2010 г. « Влияние неоднородной ресурсоемкости на технические изменения и рост », Канадский журнал экономики, Канадская экономическая ассоциация, т. 43 (4), страницы 1173-1197, ноябрь.
    16. Пол Скоу, 2000.« Загрязняющие невозобновляемые ресурсы и рост », Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т. 16 (2), страницы 211-227, июнь.
    17. Кристиан Шольц и Георг Цимес, 1999. « Неиссякаемые ресурсы, монополистическая конкуренция и эндогенный рост », Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т. 13 (2), страницы 169-185, март.
    18. Андре Гримо и Люк Руж, 2008.« Окружающая среда, Управляемые технические изменения и экономическая политика », Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т. 41 (4), страницы 439-463, декабрь.
      • Гримо, Андре и Руже, Люк, 2007. « Окружающая среда, Управляемые технические изменения и экономическая политика », Рабочие документы IDEI 384, Institut d'Economie Industrielle (IDEI), Тулуза.
      • Андре Гримо и Люк Руж, 2008. « Окружающая среда, направленные технические изменения и экономическая политика ,» Пост-печать хал-02665298, HAL.
    19. Christian Groth & Poul Schou, 2002. « Могут ли невозобновляемые ресурсы облегчить резкий характер эндогенного роста? », Oxford Economic Papers, Oxford University Press, vol. 54 (3), страницы 386-411, июль.
      • Кристиан Грот, 2000. « Могут ли невозобновляемые ресурсы облегчить острый характер эндогенного роста? », Материалы Всемирного конгресса эконометрического общества 2000 г. 1480 г., Эконометрическое общество.
      • Christian Groth & Poul Schou, 2000.« Могут ли невозобновляемые ресурсы облегчить острый характер эндогенного роста », Документы для обсуждения 00-02, Копенгагенский университет. Факультет экономики.
      • Грот, К. и Скоу, П., 2000. « Могут ли невозобновляемые ресурсы облегчить острый характер эндогенного роста », Статьи 00-02, Карлтон - Школа государственного управления.
    20. Хидео Сузуки, 1976 г. « О возможности устойчивого роста душевого потребления в экономике с истощающимися и невосполнимыми ресурсами », Обзор экономических исследований, Oxford University Press, vol.43 (3), страницы 527-535.
    21. Лукас Бретчгер и Александра Виноградова, 2018. « Спасение от дамоклова меча: эндогенные климатические потрясения в растущей экономике », Серия рабочих документов CER-ETH по экономике 18/291, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
    22. Ди Мария, Коррадо и Валенте, Симоне, 2008 г. « Хикс встречает Хотеллинг: направление технических изменений в капитале - ресурсная экономика », Окружающая среда и экономика развития, Cambridge University Press, vol.13 (6), страницы 691-717, декабрь.
    23. Лукас Бретчгер и Симона Валенте, 2011 г. « Изменение климата и неравномерное развитие », Скандинавский журнал экономики, Wiley Blackwell, vol. 113 (4), страницы 825-845, декабрь.
    24. Джозеф Стиглиц, 1974. « Рост с использованием неисчерпаемых природных ресурсов: эффективные и оптимальные пути роста », Обзор экономических исследований, Oxford University Press, vol. 41 (5), страницы 123-137.
    25. Парта Дасгупта и Джеффри Хил, 1974.« Оптимальное исчерпание исчерпаемых ресурсов », Обзор экономических исследований, Oxford University Press, vol. 41 (5), страницы 3-28.
    26. Кристиан Грот, 2006. « Новая перспектива роста невозобновляемых ресурсов », Документы для обсуждения 06-26, Копенгагенский университет. Факультет экономики.
    Полные ссылки (включая те, которые не соответствуют элементам в IDEAS)

    Самые популярные товары

    Это элементы, которые чаще всего цитируют те же работы, что и эта, и цитируются в тех же работах, что и эта.
    1. Бретчгер, Лукас, 2017. « Климатическая политика и экономический рост ,» Экономика ресурсов и энергетики, Elsevier, vol. 49 (C), страницы 1-15.
    2. Bretschger, Lucas & Smulders, Sjak, 2012. « Устойчивость и замещение исчерпаемых природных ресурсов ,» Журнал экономической динамики и управления, Elsevier, vol. 36 (4), страницы 536-549.
    3. Бретчгер, Лукас, 2020. « Мальтус в свете изменения климата », Европейский экономический обзор, Elsevier, vol.127 (С).
    4. Лукас Бретчгер, 2018. «« Зеленая экономика »,« Седеющее общество », » CER-ETH Press, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich, выпуск 2, № 18-001, декабрь.
    5. Лукас Бретчгер и Эймилия Паттаку, 2019. « Как бы плохо ни было: как функции, наносящие ущерб климату, влияют на экономический рост и социальные издержки углерода », Экономика окружающей среды и ресурсов, Springer; Европейская ассоциация экономистов-экологов и специалистов по ресурсам, т.72 (1), страницы 5–26, январь.
    6. Maciej Malaczewski, 2018. « Природные ресурсы как источник энергии в простой модели экономического роста », Бюллетень экономических исследований, Wiley Blackwell, т. 70 (4), страницы 362-380, октябрь.
    7. Бретчгер, Л. и Смолдерс, Дж. А., 2003. « Устойчивость и замещение исчерпаемых природных ресурсов: как цены на ресурсы влияют на долгосрочные инвестиции в НИОКР », Другие публикации TiSEM 2ae844f6-5ea5-45d4-963d-1, Тилбургский университет, Школа экономики и менеджмента.
      • Лукас Бретчгер и Сяк Смолдерс, 2004 г. « Устойчивость и замещение истощаемых природных ресурсов. Как цены на ресурсы влияют на долгосрочные инвестиции в НИОКР », Серия рабочих документов CER-ETH по экономике 26.03, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
      • Бретчгер, Л. и Смолдерс, Дж. А., 2003. « Устойчивость и замещение исчерпаемых природных ресурсов: как цены на ресурсы влияют на долгосрочные инвестиции в НИОКР », Документ для обсуждения 2003-71, Тилбургский университет, Центр экономических исследований.
      • Лукас Бретчгер и Сяк Смолдерс, 2003 г. « Устойчивость и замещение исчерпаемых природных ресурсов. Как цены на ресурсы влияют на долгосрочные инвестиции в НИОКР », Рабочие бумаги 2003. 87, Фонд Эни Энрико Маттеи.
    8. Вэй Цзинь и Чжун Сян Чжан, 2018. « Накопление капитала,« зеленый парадокс »и нецелевые активы: эндогенная перспектива роста », Рабочие бумаги 2018.33, Фонд Эни Энрико Маттеи.
    9. Burghaus, Kerstin & Funk, Питер, 2013.« Эндогенный рост, экологические инновации и замедление ВВП в мире с загрязняющими производственными ресурсами », Ежегодная конференция VfS 2013 (Дюссельдорф): Политика конкуренции и регулирование в условиях глобального экономического порядка 80022, Verein für Socialpolitik / Немецкая экономическая ассоциация.
    10. Эрикссон, Клас, 2018. « Поэтапный отказ от загрязняющих веществ в модели роста с направленными технологическими изменениями », Экономическое моделирование, Elsevier, vol. 68 (C), страницы 461-474.
    11. Карен Питтель и Лукас Бретчгер, 2010 г.« Влияние неоднородной ресурсоемкости на технические изменения и рост », Канадский журнал экономики, Канадская экономическая ассоциация, т. 43 (4), страницы 1173-1197, ноябрь.
    12. Рё Хории и Масако Икефудзи, 2014 г. « Окружающая среда и рост ,» Документы для обсуждения в DSSR 21 год, Высшая школа экономики и менеджмента, Университет Тохоку.
      • Рё Хории и Масако Икефудзи, 2014 г. « Окружающая среда и рост ,» Рабочие бумаги 2014 г.37, Фонд Эни Энрико Маттеи.
      • Хории, Ре и Икефудзи, Масако, 2014. « Окружающая среда и рост ,» Бумага MPRA 53624, Университетская библиотека Мюнхена, Германия.
      • Хории, Ре и Икефудзи, Масако, 2014. « Окружающая среда и рост ,» Изменение климата и устойчивое развитие 172431, Фонд Эни Энрико Маттеи (FEEM).
    13. Борисов, Кирилл и Браусманн, Александра и Бретчгер, Лукас, 2019. « Цены на выбросы углерода, переход технологий и развитие на основе навыков », Европейский экономический обзор, Elsevier, vol.118 (C), страницы 252-269.
      • Кирилл Борисов и Лукас Бретчгер, 2018. « Ценообразование за выбросы углерода, переход технологий и развитие на основе навыков », Серия рабочих документов CER-ETH по экономике 18/297, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
      • Кирилл Борисов, Лукас Бретчгер и Александра Виноградова, 2018. « Ценообразование за выбросы углерода, переход технологий и развитие на основе навыков », Серия рабочих документов CER-ETH по экономике 18/285, CER-ETH - Центр экономических исследований (CER-ETH) в ETH Zurich.
    14. Smulders, Sjak & Withagen, Cees, 2012. « Зеленый рост - уроки теории роста », Серия рабочих документов по исследованию политики 6230, Всемирный банк.
    15. Андре, Франсиско Дж. И Смолдерс, Сяк, 2014 г. « Подпитка роста в период пика добычи нефти: Направленные технологические изменения и ограничения эффективности », Европейский экономический обзор, Elsevier, vol. 69 (C), страницы 18-39.
    16. Сильва, Сусана и Соарес, Изабель и Афонсо, Оскар, 2013.« Экономические и экологические последствия дефицита ресурсов и замены возобновляемых и невозобновляемых ресурсов », Энергетическая политика, Elsevier, vol. 54 (C), страницы 113-124.
    17. Сасаки, Хироаки, 2019. « Невозобновляемые ресурсы и возможность устойчивого экономического развития в условиях положительного или отрицательного роста населения. Экономика », Бумага MPRA 92204, Университетская библиотека Мюнхена, Германия.
    18. Такео Хори и Хироаки Ямагами, 2018. « Защита прав интеллектуальной собственности при наличии исчерпаемых ресурсов ,» Исследования в области экономики и политики окружающей среды, Springer; Общество исследований в области экономики и политики окружающей среды - SEEPS, vol.20 (4), страницы 759-784, октябрь.
    19. Fabre, Adrien & Fodha, Mouez & Ricci, Francesco, 2020. « Минеральные ресурсы для возобновляемых источников энергии: оптимальные сроки производства энергии », Экономика ресурсов и энергетики, Elsevier, vol. 59 (С).
      • Адриен Фабр, Моуэз Фодха и Франческо Риччи, 2019 г. « Минеральные ресурсы для возобновляемых источников энергии: оптимальные сроки производства энергии », Рабочие бумаги 2019.06, FAERE - Французская ассоциация экономистов-экологов и специалистов по ресурсам.
      • Адриен Фабр, Моуэз Фодха и Франческо Риччи, 2020. « Минеральные ресурсы для возобновляемых источников энергии: оптимальные сроки производства энергии », PSE-Ecole d'économie de Paris (Постпринт) хал-02446805, HAL.
      • Адриен Фабр, Моуэз Фодха и Франческо Риччи, 2020. « Минеральные ресурсы для возобновляемых источников энергии: оптимальные сроки производства энергии », Пост-печать хал-02446805, HAL.
      • Адриен Фабр, Моуэз Фодхаз и Франческо Риччи, 2019.« Минеральные ресурсы для возобновляемых источников энергии: оптимальные сроки производства энергии », Рабочие бумаги хал-02056348, HAL.
      • Адриен Фабр, Моуэз Фодхаз и Франческо Риччи, 2019. « Минеральные ресурсы для возобновляемых источников энергии: оптимальные сроки производства энергии », Рабочие документы CEE-M hal-02056348, CEE-M, Университет Монпелье, CNRS, INRA, Montpellier SupAgro.
    20. Михаил Голосов, Джон Хасслер, Пер Крузелл и Олег Цывинский, 2014.« Оптимальные налоги на ископаемое топливо в общем равновесии », Econometrica, Econometric Society, vol. 82 (1), страницы 41-88, январь.
      • Голосов, Михаил и Хасслер, Джон и Крузелл, Пер и Цывински, Олег, 2011. « Оптимальные налоги на ископаемое топливо в общем равновесии », Документы для обсуждения CEPR 8527, C.E.P.R. Документы для обсуждения.
      • Михаил Голосов, Джон Хасслер, Пер Крузелл и Олег Цывинский, 2011. « Оптимальные налоги на ископаемое топливо в общем равновесии », Рабочие документы NBER 17348, Национальное бюро экономических исследований, Inc.

    Подробнее об этом товаре

    Ключевые слова

    Природная среда; эндогенный рост; многосекторная модель; плохая подмена; рост населения;
    Все эти ключевые слова.

    Классификация JEL:

    • Q43 - Экономика сельского хозяйства и природных ресурсов; Окружающая среда и экологическая экономика - - Энергия - - - Энергия и макроэкономика
    • O47 - Экономическое развитие, инновации, технологические изменения и рост - - Экономический рост и совокупная производительность - - - Эмпирические исследования экономического роста; Совокупная производительность; Конвергенция результатов по странам
    • Q56 - Экономика сельского хозяйства и природных ресурсов; Экологическая и экологическая экономика - - Экологическая экономика - - - Окружающая среда и развитие; Окружающая среда и торговля; Устойчивость; Экологические счета и бухгалтерский учет; Экологическая справедливость; Прирост населения
    • O41 - Экономическое развитие, инновации, технологические изменения и рост - - Экономический рост и совокупная производительность - - - Одно-, двух- и многосекторные модели роста

    Поля нэпа

    Этот документ был анонсирован в следующих отчетах нэпа:

    Статистика

    Доступ и загрузка статистики

    Исправления

    Все материалы на этом сайте предоставлены соответствующими издателями и авторами.Вы можете помочь исправить ошибки и упущения. При запросе исправления укажите дескриптор этого элемента: RePEc: eth: wpswif: 16-260 . См. Общую информацию о том, как исправить материал в RePEc.

    По техническим вопросам, касающимся этого элемента, или для исправления его авторов, заголовка, аннотации, библиографической информации или информации для загрузки, обращайтесь: (). Общие контактные данные провайдера: https://edirc.repec.org/data/iwethch.html .

    Если вы создали этот элемент и еще не зарегистрированы в RePEc, мы рекомендуем вам сделать это здесь.Это позволяет связать ваш профиль с этим элементом. Это также позволяет вам принимать потенциальные ссылки на этот элемент, в отношении которого мы не уверены.

    Если CitEc распознал ссылку, но не связал с ней элемент в RePEc, вы можете помочь с этой формой .

    Если вам известно об отсутствующих элементах, цитирующих этот элемент, вы можете помочь нам создать эти ссылки, добавив соответствующие ссылки таким же образом, как указано выше, для каждого ссылочного элемента. Если вы являетесь зарегистрированным автором этого элемента, вы также можете проверить вкладку «Цитаты» в своем профиле RePEc Author Service, поскольку там могут быть некоторые цитаты, ожидающие подтверждения.

    Обратите внимание, что исправления могут занять пару недель, чтобы отфильтровать различные сервисы RePEc.

    15N Гиперполяризация далфампридина при естественном изобилии для МРТ

    Abstract

    Усиление сигнала путем обратимого обмена (SABER) - многообещающий метод усиления сигнала ЯМР и получения гиперполяризованных молекул. Поскольку времена релаксации ядерных спинов гетероядер обычно намного больше, чем у протонов, основанная на SABER гиперполяризация гетероядер в молекулах очень важна в контексте биомедицинских приложений.В этой работе мы демонстрируем, что метод SLIC-SABER может быть успешно использован для гиперполяризации ядер 15 N в дальфампридине. Высокий уровень поляризации ок. 8%, достигнутые в данной работе, позволили нам впервые получить 15 N МР-изображений при естественном изобилии ядер 15 N.

    Ключевые слова: параводород, SABRE, 15 N естественное содержание, гиперполяризация, МРТ

    Graphical Abstract

    32000-кратное усиление сигнала ЯМР 15 N (7.8% спиновая поляризация) была достигнута для биологически активной молекулы дальфампридина с использованием комбинации методов усиления сигнала посредством обратимого обмена и индуцированного перекрестного пересечения спиновой блокировки в сильном магнитном поле. Это значительное усиление сигнала ЯМР 15 N позволило впервые получить МР-изображение FAM 15 N с естественным содержанием изотопа 15 N.

    Дальфампридин (FAM) или 4-аминопиридин - это лекарство, которое может значительно уменьшить симптомы рассеянного склероза. [1] FAM не влияет на течение самого заболевания, но используется для улучшения симптомов ходьбы у взрослых с несколькими вариантами заболевания. [2,3] Его действие основано на блокировании калиевых каналов. Это приводит к увеличению проводимости потенциала действия в демиелинизированных нервных волокнах. [2,3] Этот препарат одобрен регулирующими органами в США, Канаде и Европе, и продается как Ampyra и Fampyra. Распределение лекарства в организме, биохимические пути его трансформации, а также его метаболический профиль являются важной информацией для определения эффективности лекарства.Магнитно-резонансная томография (МРТ), будучи неинвазивным методом с высоким содержанием информации, позволяет эффективно получать эти уникальные данные. Однако ядерный магнитный резонанс (ЯМР) и МРТ имеют относительно низкую чувствительность. [4] Это связано с тем, что разница в населенности состояний ядерного спина (называемая поляризацией ядерного спина P ) мала. Для ядер 1 H тепловая поляризация составляет всего 1,02 · 10 −5 в магнитном поле 3 Тл, [4] и для других ядер с ЯМР-активностью со спином 1/2 (например.грамм. 13 C, 15 N, 19 F, 31 P) с их меньшими гиромагнитными отношениями еще меньше. Хотя этот уровень поляризации достаточен для выполнения МРТ in vivo на основе сигнала 1 H ЯМР воды в тканях, выполнение in vivo 1 H МРТ для любых других молекул на сильном фоне сигнала воды крайне неблагоприятно. Использование гетероядер (например, 15 N) смягчает эту проблему, поскольку их концентрация в тканях значительно ниже по сравнению с 1 H.Что еще более важно, эти ядра часто имеют очень большое время релаксации T 1 до десяти минут, [5] , что очень полезно, когда задействованы переходные неравновесные спиновые поляризации (см. Ниже).

    Широкий спектр биологически значимых молекул, таких как азотистые основания, ДНК, РНК, аминокислоты, пептиды, белки, витамины, гормоны и лекарства, содержат атомы азота. Прямое использование термически поляризованного сигнала ядер 15 N для in vivo МРТ очень сложно из-за очень низкого естественного содержания изотопа 15 N (0.365%) и более низкое гиромагнитное отношение ядер 15 N по сравнению с 1 H (~ 1:10), что приводит к низкой чувствительности обнаружения. В результате на сегодняшний день было сообщено об ограниченном количестве исследований 15 N МРТ с молекулами, не обогащенными изотопами. [6] Таким образом, использование гетероядер в МРТ требует дополнительных усилий для повышения чувствительности обнаружения. Гиперполяризация ЯМР (ГП) позволяет значительно увеличить P до порядка единицы с соответствующим увеличением чувствительности обнаружения.В методе усиления сигнала путем обратимого обмена (SABER) используется одновременный химический обмен параводорода и гиперполяризованного субстрата в металлическом комплексе. [7–11] Параводород служит источником гиперполяризации в этом методе, и были разработаны два подхода SABER. Первый подход основан на статическом магнитном поле для создания антипересечений уровней (LAC) для спонтанной передачи порядка ядерных спинов от параводорода к гиперполяризованному субстрату. [12] В случае ядер 15 N, этот процесс наиболее эффективен в магнитных полях субмикротесла (примерно 0,2–0,4 мкТл). [6,13] Усиление сигнала за счет обратимого обмена в щите обеспечивает перенос выравнивания в гетероядры (SABER-SHEATH) был использован для гиперполяризации широкого спектра биологически значимых 15 N-меченных молекул, включая биологически активные, с 15 N поляризация более 24%. [6,14–18] В некоторых случаях достигнутого усиления было достаточно для проведения спектроскопического обнаружения при естественном содержании ядер 15 N. [19] Необходимость использования магнитного экрана и необходимость передачи образца из магнитных полей микротесла в сканер МРТ для считывания сигнала являются ключевыми недостатками этого подхода. Хотя SABRE ядер 15 N была продемонстрирована в сильном магнитном поле 9,4 Тл (стратегия HF-SABRE), [20,21] достигнутые уровни поляризации были очень низкими (<0,1%) и, следовательно, непривлекательными. для биомедицинских приложений. Альтернативный подход основан на использовании ВЧ-импульсов вместо статических магнитных полей для передачи порядка ядерных спинов от параводорода к гиперполяризованным подложкам в сильных магнитных полях. [22,23]

    Для этой цели был разработан ряд последовательностей РЧ-импульсов, включая SABRE с переменными задержками для достижения передачи поляризации (ADAPT-SABER), [24] Нечувствительные ядра SABRE, усиленные передачей поляризации (SABRE- INEPT), [25] Генерация SABRE с высоким Тесла (LIGHT-SABRE) с низким уровнем облучения, [26] SABRE, индуцированное перекрестным замыканием спина (SLIC-SABRE), [27] Квазирезонансная SABRE (QUASR- SABRE) [28] и другие.Однако достигнутые уровни поляризации P 15N на сегодняшний день не превышают 1% ни с одним из подходов, основанных на RF.

    В настоящей работе мы использовали подход SLIC-SABER для переноса гиперполяризации с pH 2 на ядра 15 N в дальфампридине (FAM) и 4-диметиламинопиридине (DMAP) для обнаружения 15 N MR. изображения FAM и DMAP при естественной численности 15 N ().

    Генерация бесплатных носителей HP в подходе SLIC-SABER. [29]

    Мы использовали ранее разработанный катализатор IrIMes, экспериментальную установку и технику SLIC-SABER для гиперполяризации 15 N DMAP и FAM в сильном магнитном поле (см. Экспериментальный раздел, SI). [27,29] Параметры последовательности импульсов SLIC-SABER, такие как длительность импульса непрерывной волны (CW), количество циклов и скорость потока, были ранее оптимизированы (SI). [29] 15 спектров N ЯМР и 15 МР изображений (см. Ниже) были записаны после накачки SLIC с оптимизированными параметрами (SI).

    Сначала в качестве субстрата использовали DMAP с естественным содержанием 15 N. Барботирование p-H 2 через раствор DMAP и катализатора SABER в сильном магнитном поле (7,1 Тл) привело к спектру ЯМР 15 N с сигналом HP при 216 м.д., соответствующим DMAP, связанному с комплексом SABER (рис. S1). Этот сигнал использовался для оптимизации последовательности импульсов SLIC (Таблица S1). 15 Усиление сигнала N свободного DMAP было ~ 29 800 раз при 7,1 Тл, что соответствует 7.2% 15 Поляризация N ( P 15N ) в оптимальных условиях (). Этот уровень поляризации 15 N примерно в 7 раз больше, чем любой из ранее достигнутых P 15N любым методом RF-SABER.

    15 Спектры ЯМР HP DMAP (A) и FAM (B) с естественным содержанием изотопа 15 N, записанные с использованием метода SLIC-SABER при комнатной температуре и избыточном давлении 4,4 бар. Для последовательности импульсов SLIC-SABER длительность непрерывного импульса составляла 1.17 с, v 1 = 5 Гц, v срез = 13 Гц, а количество циклов было 30 (A) и 40 (B). Использовали 0,1 М растворы DMAP и FAM с естественным содержанием изотопа 15 N в 5-миллиметровой пробирке для ЯМР. Расход p-H 2 составлял 80 см 3 / мин. Спектр ЯМР 15 N 4,9 М раствора DMAP, записанный с 512 накоплениями, использовали в качестве эталона сигнала (C). Подробная оценка факторов усиления представлена ​​в SI.

    Ранее было показано, что замена субстрата с пиридина- 15 N на 3-фторпиридин-1- 15 N приводит к значительному снижению P 15N ок.30 раз). [30,31] Мы связываем этот эффект с электроноакцепторным индуктивным эффектом на пиридиновый гетероцикл, приводящим к снижению эффективности гиперполяризации в контексте SABER-SHEATH [30,32,33] . При этом система IrIMes-DMAP демонстрирует наивысший уровень 15 N SABRE. Мы связываем это с наличием электронодонорной группы, которая, вероятно, увеличивает электронную плотность у атома азота за счет положительного мезомерного эффекта и тем самым увеличивает эффективность переноса гиперполяризации SABER.

    FAM, будучи лекарственным средством, является многообещающим соединением для использования в биомедицинских приложениях. Сигнал от связанного с катализатором FAM наблюдали в спектре ЯМР 15 N при ~ 218 ppm, в то время как pH 2 барботировали через раствор (рис. S1), и этот сигнал использовали для оптимизации последовательности SLIC-SABER. . Сигнал 15 N ЯМР свободного FAM при около . 260 ppm увеличилось в ~ 32100 раз, что соответствует P 15N на 7,8% () в оптимизированных условиях (Таблица S1). P 15N FAM был больше по сравнению с DMAP, вероятно, потому, что группа NH 2 - является более сильным донором электронов, чем заместитель N (CH 3 ) 2 -.

    Мы использовали HP DMAP, чтобы продемонстрировать возможность МРТ 15 N при естественном уровне изотопа 15 N (). Общее время эксперимента, включая гиперполяризацию SLIC и обнаружение сигнала МРТ, составило 43 с. Обратите внимание, что время релаксации обоих субстратов составляло около 37 с (рис. S5), и поэтому общее время МРТ-эксперимента 43 с подходит для их визуализации.Таким образом, впервые применение подхода SLIC-SABER позволило получить МР-изображение 15 N субстрата HP при естественном содержании ядер 15 N (концентрация 15 N составляла 1,8 мМ) с хорошее соотношение сигнал / шум и пространственное разрешение. Немного более высокое усиление сигнала 15 N ЯМР молекулы FAM позволило нам получить МР-изображение 15 N с лучшим соотношением сигнал / шум, чем для DMAP (109 против 49) при естественном изобилии содержания (0.365%) 15 N в 0,5 М растворах субстрата в 10 мм ЯМР.

    2D 15 N FLASH MRI HP DMAP и FAM: XY-проекционное изображение трубки ЯМР 10 мм. Пустота в центре соответствует наличию капилляра, питающего p-H 2 . Параметры импульса SLIC-SABER: длительность непрерывного импульса составляла 1,17 с, v 1 = 5 Гц, v срез = 13 Гц, количество циклов составляло 30 для (A) и 40 для (B). Скорость потока p-H 2 составляла 140 кубических сантиметров в секунду для (A) и 100 кубических футов в минуту для (B), а избыточное давление p-H 2 составляло 4.Было использовано 4 бара. Эксперименты проводились при комнатной температуре. TR = 3,1 мс, TE = 1,5 мс. SW = 10 кГц, пространственное разрешение 0,3 × 2,4 мм 2 / пиксель. Поле зрения 3,8 × 3,8 см 2 . Матрица сбора данных была 128 × 16, и она была заполнена нулями до размера матрицы 128 × 128.

    В заключение, мы продемонстрировали очень эффективный RF-SABER для гиперполяризации 15 N биосовместимой молекулы в качестве примера. Высокие уровни поляризации 15 N (~ 8%) позволили нам впервые продемонстрировать возможность применения МРТ 15 N при естественном содержании ядер 15 N.Это важно, потому что SABRE-совместимые мотивы многообещающих лекарств могут быть потенциально изучены на предмет их пригодности для гиперполяризации SABRE и МРТ без необходимости трудозатрат - примерно 15 N изотопного обогащения. Показанные здесь уровни поляризации (около 8%) могут быть потенциально дополнительно улучшены за счет использования почти 100% p-H 2 (по сравнению с 87% p-H 2 , используемых здесь) [11] . В целом, значительный прогресс в уровнях поляризации 15 N, продемонстрированный в этой работе, потенциально может сделать технику SLIC-SABER полезной для будущих биомедицинских приложений.Более того, недавние преимущества в 15 N MRI-визуализации [34] и удалении катализатора SABRE [35,36] открывают новые перспективы для сверхбыстрой визуализации контрастных веществ, не содержащих гомогенный катализатор.

    Экспериментальная часть

    Комплексы иридия с N-гетероциклическим карбеновым лигандом Ir (COD) (IMes) Cl (IMes = 1,3-бис (2,4,6-триметилфенил) имидазол-2-илиден и COD = циклооктадиен ), использовался в качестве предварительного катализатора для создания гиперполяризации SABRE.Этот комплекс синтезирован по опубликованной методике. [37] Предварительный катализатор активировали барботированием p-H 2 (20 sccm при избыточном давлении 2,7 бар) в течение 30 минут через раствор, содержащий субстрат, S . Эксперименты SLIC-SABER для DMAP (Aldrich, CAS: 1122-58-3, # 107700) и FAM (Aldrich, CAS: 504-24-5, # A78403) проводили с использованием 0,6 мл 0,1 М раствора субстрата и 5 мМ катализатора IrIMes в трубке для ЯМР 5 мм. МРТ-эксперименты с DMAP и FAM проводились с использованием 3 мл 0.5 М раствор субстрата и 5 мМ катализатора IrIMes в трубке 10 мм. 15 N ЯМР-спектры DMAP, FAM и MNZ- 15 N 2 регистрировали на ЯМР-спектрометре 300 МГц. МР-изображения получали с использованием прибора для микроизображения 400 МГц (B 0 = 9,4 T) (Bruker, Avance III), оснащенного двухканальным датчиком ( 1 H, 15 N) и силой градиента до 150 г / см. Последовательность импульсов SLIC использовалась для передачи порядка ядерных спинов с p-H 2 на 15 Н в сильном магнитном поле.

    Для МРТ использовалась последовательность импульсов градиентного эха. Полный набор данных в k-пространстве был получен после одного блока SLIC-SABER. В этой настройке гиперполяризация SLIC-SABER заняла 43 с (30 циклов), а МРТ FLASH менее 1 с (время повторения (TR) 3,1 мс, время эха (TE) 1,5 мс, 16 шагов кодирования фазы, 128 точек считывания. , Декартова кодировка). Были усреднены четыре сканирования. Вначале p-H 2 был пропущен через раствор с расходом 80 sccm и избыточным давлением 4,4 бара.Важно отметить, что поток p-H 2 был остановлен за 4-6 секунд до начала МРТ, чтобы уменьшить неоднородности магнитного поля и быструю конвекцию, вызванную пузырьками. Из-за аппаратных ограничений при переключении между двумя последовательностями импульсов задержка между SLIC-SABRE и MRI составляла примерно 2–4 с. Градиент фазового кодирования имел силу 8% от максимального значения и длительность 400 мкс, а градиент считывания имел силу 4% и длительность 2,1 мс. Угол поворота составлял 30 °. Фильтр k-space не применялся.В результате было получено 15 N изображений с использованием матрицы 128 × 16, что дало пространственное разрешение 0,3 × 2,4 мм 2 / пиксель. Для презентации наборы данных k-пространства были заполнены нулями до 128 × 128.

    Ожидается, что глобальный рынок испытательного оборудования на электромагнитную совместимость (ЭМС) вырастет на 519,09 млн долларов в течение 2021-2025 годов, при этом среднегодовой темп роста 5% в прогнозируемый период

    CBC

    Новый полевой госпиталь в Торонто готовится принять COVID- 19 пациентов в отделениях интенсивной терапии переполнены

    Новый полевой госпиталь, построенный на стоянке в Центре медицинских наук Саннибрук в Торонто, вероятно, будет готов принимать пациентов на этой неделе, поскольку больницы по всему региону пытаются справиться с рекордным ростом числа случаев COVID-19.Мобильное медицинское учреждение, как оно официально известно, будет оказывать помощь пациентам, которые выздоравливают или выздоровели от COVID-19. Это подразделение позволит Саннибруку освободить коек в больницах во время третьей волны пандемии. В отделении площадью 2088 квадратных метров, размещенном в нескольких зеленых палатках, поддерживаемых алюминиевым каркасом, есть 84 койки для пациентов, которые при необходимости можно расширить до 100 коек. По словам менеджера временного медицинского учреждения, на этой неделе больница надеется открыть в отделении 20 коек.Роберт Берджесс, старший директор Саннибрука по догоспитальной медицине, потоку пациентов и готовности к чрезвычайным ситуациям, заявил в понедельник, что на этой неделе больница завершает работу над отделением. «Мы буквально на последнем этапе с точки зрения структурной установки», - сказал Берджесс, надев маску внутри подразделения. Отделение готовится в то время, когда больницы GTA настолько переполнены из-за регистрации случаев COVID-19, что некоторых пациентов переводят в другие медицинские центры за пределами региона, включая юго-западный Онтарио.Вид изнутри мобильного медицинского пункта в Центре медицинских наук Саннибрук в Торонто, 19 апреля 2021 года. (Кевин Ван Паассен / Центр медицинских наук Саннибрук) «На этой неделе мы готовимся как можно скорее к началу приема пациентов в ", - добавил Берджесс. «Очевидно, что когда вы открываете новую больницу или открываете палату в больнице, вам предстоит много поработать над кадровыми планами. Мы работаем над этими планами, чтобы обеспечить безопасность», - сказал он. добавлен. «Буквально с каждым часом мы приближаемся к тому моменту, когда мы можем начать принимать пациентов на регулярной основе.Надеюсь, что на этой неделе мы сможем начать привозить некоторых пациентов. Если это безопасно, мы продолжим. Мы все с нетерпением ждем начала этого процесса ». СМОТРИ | Полевой госпиталь в Торонто,« инструмент в ящике для инструментов »для увеличения нагрузки на пациентов, - говорит специалист по планированию действий в чрезвычайных ситуациях: Бёрджесс сказал, что больница хочет избежать попадания в отделение тяжелобольных пациентов. Каждый блок состоит из восьми человек. до 10 коек является автономным. Несколько больших генераторов обеспечивают питание для этого блока. Он сказал, что есть много окон для освещения. Он сказал, что "было бы здорово", если бы давление на систему здравоохранения в Онтарио, больница не нуждалась в установке и вскоре могла ее демонтировать.«Он должен быть здесь как еще один инструмент в наборе инструментов для обеспечения готовности к чрезвычайным ситуациям. На это мы надеемся, но мы готовы помочь провинции, если ситуация изменится», - сказал он. В блоке площадью 2088 квадратных метров, размещенном в нескольких зеленых палатках, поддерживаемых алюминиевым каркасом, есть 84 койки для пациентов, которые при необходимости можно расширить до 100 коек. (Эван Мицуи / CBC) Берджесс сказал, что укомплектование кадрами завершается с помощью министерства здравоохранения Онтарио. В настоящее время в больнице проходят обучение сотрудников, они проводят ориентацию и проводят симуляции внутри отделения, чтобы люди чувствовали себя комфортно там, работая.«Мы везде ищем дополнительный персонал», - сказал он. Он описал это подразделение как «системный ресурс», что означает, что оно может оказывать помощь больницам в других районах провинции, где существует давление на систему здравоохранения. Саннибрук попросили обеспечить, чтобы установка была запущена и работала как минимум три месяца. По его словам, этот период времени может быть увеличен в зависимости от потребностей и количества пациентов. Бёрджесс признал, что блок выглядит как несколько палаток снаружи и может быть поразительным, но сказал, что блок сложен внутри.«Это конструкции, которые были разработаны для медицинских целей. Когда вы окажетесь внутри, они будут очень сложными, безопасными и очень удобными», - сказал он. «Мы спроектировали конструкцию таким образом, чтобы она была безопасной для пациентов и персонала. Надеюсь, пациенты и персонал будут приятно удивлены, когда впервые увидят внутреннюю часть». Строящийся полевой госпиталь на территории Саннибрукского центра здравоохранения в Торонто, 6 апреля 2021 г. (Эван Мицуи / CBC)

    Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    Геномы азоспирилл выявляют переход бактерий из водной среды в наземную

    Образец цитирования: Вишневски-Дье Ф., Борзяк К., Хальса-Мойерс Г., Александр Г., Сухарников Л.О., Вуичет К. и др.(2011) Азоспириллы Геномы выявляют переход бактерий из водных в наземные среды. PLoS Genet 7 (12): e1002430. https://doi.org/10.1371/journal.pgen.1002430

    Редактор: Пол М. Ричардсон, Progentech, Соединенные Штаты Америки

    Поступила: 9 сентября 2011 г .; Принята к печати: 2 ноября 2011 г .; Опубликовано: 22 декабря 2011 г.

    Авторские права: © 2011 Wisniewski-Dyé et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Финансирование: Эта работа была частично поддержана грантами EF-0412186, EF-0728827 (IBZ и AHP) и MCB-0622277 (GA) от Национального научного фонда и средствами Научного центра биоэнергетики Министерства энергетики (IBZ). ) и Программа геномных наук (GBH и WHM), которые поддерживаются Управлением биологических и экологических исследований Управления науки Министерства энергетики США.Эта работа также была поддержана проектом ANR AZORIZ (ANR-08-BLAN-0098), Институтом экологии и окружающей среды CNRS (Франция) и грантом Австралийского исследовательского совета DP0771664 (IK и IBZ). Научный центр биоэнергетики - это Министерство энергетики США. Центр исследований биоэнергетики при поддержке Управления биологических и экологических исследований Управления науки Министерства энергетики США. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

    Введение

    Летописи окаменелостей показывают, что жизнь появилась в морской среде ∼3,5–3,8 миллиарда лет назад (млрд лет назад) [1] и перешла в наземные экосистемы ∼2,6 млрд лет [2]. Отсутствие сведений об окаменелостях бактерий затрудняет оценку сроков их перехода в наземную среду; однако анализ последовательности предполагает, что большая клада прокариотических типов (названная «террабактериями») могла развиться на суше уже через 3 млрд лет, а некоторые линии позже повторно вторглись в морские среды обитания [3].Например, цианобактерии принадлежат к кладе террабактерий, но один из их хорошо изученных представителей, Prochlorococcus , является доминирующим первичным продуцентом в океанах [4].

    Бактерии рода Azospirillum встречаются в основном в наземных средах обитания, где они колонизируют корни важных злаков и других трав и способствуют росту растений с помощью нескольких механизмов, включая фиксацию азота и секрецию фитогормонов [5], [6]. Азоспириллы относятся к протеобактериям, одной из крупнейших групп «гидробактерий», клада прокариот, возникших в морской среде [3].Почти все известные представители семейства Rhodospirillaceae встречаются в водных средах обитания (рис. 1 и таблица S1), что позволяет предположить, что Azospirillum представляет собой линию, которая могла перейти в наземную среду намного позже, чем докембрийское разделение «гидробактерий» и «террабактерий». ». Чтобы понять, как бактерии перешли из морской среды в наземную, мы секвенировали два хорошо изученных вида: A. brasilense и A.lipoferum , а третий геном неопределенного вида Azospirillum стал доступен, когда мы выполняли эту работу [7].

    Рис. 1. Среда обитания Azospirillum и его ближайших аквабактериальных родственников.

    Дерево максимального правдоподобия, построенное из последовательностей 16S рРНК членов Rhodospirillaceae . Acetobacter acetii , член того же порядка Rhodospirillales , но другое семейство, Acetobacteriaceae , показано как внешняя группа.Водные обитатели не выделяются; наземные выделены коричневым цветом, а связанные с растениями Azospirillum выделены зеленым цветом. См. Подробности в таблице S1.

    https://doi.org/10.1371/journal.pgen.1002430.g001

    Результаты / Обсуждение

    В отличие от геномов их ближайших родственников (другие Rhodospirillaceae ), три генома Azospirillum больше и имеют состоит не из одного, а из семи репликонов каждый (рисунок S1 и таблица 1).Множественные репликоны были ранее предложены для различных штаммов Azospirillum [8]. Самый большой репликон в каждом геноме обладает всеми характеристиками бактериальной хромосомы, тогда как самый маленький репликон является плазмидой. Пять репликонов в геномах A. lipoferum и Azospirillum Sp. 510 можно определить как «хромиды» (промежуточные соединения между хромосомами и плазмидами [9]), тогда как в A. brasilense только три репликона являются «хромидами» (таблицы S2 и S3).В то время как множественные репликоны, в частности хромиды, не являются чем-то необычным для протеобактерий [9], [10], Azospirillum lipoferum имеет наибольшее количество хромидов среди всех прокариот, секвенированных на сегодняшний день [9], что указывает на потенциал пластичности генома.

    Сравнение трех геномов обнаруживает дополнительные доказательства экстраординарной пластичности генома Azospirillum , особенность, которая также была подтверждена некоторыми экспериментальными данными [11]. Мы обнаружили очень небольшую синтению между репликонами видов Azospirillum .Генетическое родство среди штаммов Azospirillum сравнимо с родством ризобий, других мультирепликонных альфа-протеобактерий (Таблица S4). Неожиданно мы обнаружили значительно больше геномных реаранжировок в геномах Azospirillum , чем в геномах ризобий (Рис. 2), которые, как предполагается, иллюстрируют пластичность генома у прокариот [10]. Это может быть следствием многих повторяющихся последовательностей и других горячих точек рекомбинации (Таблицы S4 и S5), хотя подробные механизмы, лежащие в основе такой экстраординарной пластичности генома, остаются не полностью понятыми.

    Рис. 2. Выравнивание всего генома для Azospirillum и родственных мультирепликонных видов ризобий.

    Относительные расстояния между геномами (рассчитанные из дерева конкатенированных рибосомных белков): A. lipoferum 4B до Azospirillum sp. 510 - 0,01; Rhizobium etli к Rhizobium leguminosarum - 0,02; A. lipoferum 4B до A. brasilense Sp245 - 0,10; Rhizobium etli до S. meliloti - 0.11.

    https://doi.org/10.1371/journal.pgen.1002430.g002

    Какие гены у Azospirillum общие с его водными родственниками и каково происхождение его дополнительных генов? Чтобы ответить на этот вопрос, мы разработали надежную схему для обнаружения наследственных и горизонтально переносимых (HGT) генов (Рисунок 3) с использованием инструментов биоинформатики, а затем классифицировали большинство кодирующих белки генов в геномах Azospirillum как наследственные или горизонтально переданные с количественной степенью достоверности. (Рисунок 4A и таблица S6).Примечательно, что почти половина генов в каждом геноме Azospirillum , происхождение которых может быть определено, оказались перенесенными горизонтально. В качестве контроля мы подвергли геномы других Rhodospirillaceae тому же анализу, обнаружив существенно более низкий уровень HGT у водных видов, в то время как количество предковых генов у всех организмов было сопоставимым (Рисунок 4B). Горизонтально перенесенные гены часто расходуются, тогда как предковые гены обычно служат «хозяйственным» функциям и сохраняются на больших эволюционных дистанциях [12].Для дальнейшей проверки наших классификаций мы определили функциональное назначение генов в каждой из двух категорий, используя базу данных COG [13]. «Предковый» набор в основном содержал гены, участвующие в «хозяйственных» функциях, таких как трансляция, посттрансляционная модификация, деление клеток и метаболизм нуклеотидов и коферментов (рис. 5). Набор HGT содержал большую часть генов, участвующих в определенных необходимых функциях, таких как защитные механизмы, биогенез клеточной стенки, транспорт и метаболизм аминокислот, углеводов, неорганических ионов и вторичных метаболитов (Рисунок 5 и Таблица S6).Это согласуется с ролью HGT в адаптации к ризосфере, среде, богатой аминокислотами, углеводами, неорганическими ионами и вторичными метаболитами, выделяемыми корнями растений [14].

    Рис. 4. Родовые (красный) и горизонтально перенесенный (синий) гены в Azospirillum .

    (A) Доля предковых и горизонтально перенесенных генов, предсказанных в трех геномах Azospirillum с разной степенью достоверности: интенсивность цвета показывает высокий (темный), средний (средний) и низкий (светлый) уровни достоверности для прогнозов (см. Методы).Гены, которые нельзя назначить с помощью этого протокола, показаны белым цветом. Большинство этих генов уникальны для каждого вида и не имеют идентифицируемых гомологов; таким образом, они, вероятно, являются результатом ГПГ. (B) Доля предковых и горизонтально перенесенных генов в геномах Rhodospirillaceae . Показаны только гены, которые были предсказаны с высокой степенью уверенности.

    https://doi.org/10.1371/journal.pgen.1002430.g004

    Такой необычайно высокий уровень HGT в геномах Azospirillum заставляет нас предположить, что это была основная движущая сила в переходе этих бактерий из водных организмов. к наземным условиям и адаптации к растениям-хозяевам.Этому процессу, вероятно, способствовали конъюгация и трансдукция, поскольку Azospirillum является хозяином фагов и, в частности, агента переноса генов [15]; это также должно было привести к потере наследственных «водных» генов, которые не пригодны в новой среде обитания. Действительно, одна из определяющих черт Rhodospirillaceae , фотосинтез (ответственный за первоначальное таксономическое название этих организмов - пурпурные бактерии), полностью отсутствует у Azospirillum . Мы проанализировали происхождение генов, которые, как предполагается, важны для адаптации к ризосфере и взаимодействия с растением-хозяином [6], [16].В соответствии с нашей гипотезой предполагалось, что большинство этих генов переносятся горизонтально (рисунок 6 и таблица S7). Однако важно подчеркнуть, что взаимодействия растений и микробов включают сложное взаимодействие многих функций, которые определяются как наследственными, так и горизонтально приобретенными генами.

    Рисунок 6. Доля предковых (красный) и горизонтально перенесенных (синий) генов, участвующих в адаптации Azospirillum к ризосфере и его взаимодействию с растениями-хозяевами (подробности см. В Таблице S7).

    Интенсивность цвета указывает на высокий (темный), средний (средний) и низкий (светлый) уровни достоверности для прогноза (подробности см. В разделе «Материалы и методы»).

    https://doi.org/10.1371/journal.pgen.1002430.g006

    Что было источником горизонтально перенесенных генов? Большая часть генов, которые мы отнесли к HGT, показывают родство с наземными протеобактериями, включая представителей Rhizobiales (отдаленно родственные альфа-протеобактерии) и Burkholderiales (бета-протеобактерии) (Рисунок 7), которые являются почвенными и растительными организмами. .В отсутствие данных по окаменелостям практически невозможно определить время дивергенции конкретной бактериальной линии; однако грубое приближение (1-2% расхождения в гене 16S рРНК равно 50 млн лет [17]) предполагает, что азоспириллы могли отойти от своих водных родственников Rhodospirillaceae на 200–400 млн лет (Таблица S8). Этот верхний предел времени совпадает с начальным основным излучением сосудистых растений на суше и эволюцией корней растений до 400 млн лет [18], [19]. Травы, основные растения-хозяева для Azospirillum , появились намного позже, примерно на 65–80 млн лет [20], что согласуется с сообщениями о том, что азоспириллы могут колонизировать и другие растения, кроме трав.

    Используя глобальный протеомный подход, мы обнаружили, что многие гены HGT, включая почти 1/3 общих для всех трех геномов Azospirillum , экспрессировались в стандартных экспериментальных условиях и при ограничении азота, состоянии, обычно встречающемся в ризосфере естественной природы. экосистемы (Рисунок 8 и Таблица S9).

    Рис. 8. Доля предковых (красный) и горизонтально перенесенных (синий) генов в данных протеомики для A. lipoferum 4B.

    Интенсивность цвета обозначает высокий (темный), средний (средний) и низкий (светлый) уровни достоверности прогнозов. См. Подробности в Таблице S9.

    https://doi.org/10.1371/journal.pgen.1002430.g008

    Гены, которые отличают виды Azospirillum друг от друга и от их ближайших родственников, вовлечены в специализации, такие как колонизация растений. Azospirillum и близкородственный Rhodospirillum centenum обладают множественными оперонами хемотаксиса и являются модельными организмами для изучения хемотаксиса [21], [22].Интересно, что оперон 1, который контролирует хемотаксис R. centenum [22], играет лишь незначительную роль в хемотаксисе A. brasilense [23]. Все три вида Azospirillum обладают тремя оперонами хемотаксиса, которые ортологичны оперонам R. centenum ; однако у них также есть дополнительные опероны хемотаксиса, которые отсутствуют у их близких водных родственников (Рисунок S2 и Таблицы S6 и S10). Дополнительные опероны хемотаксиса были приобретены азоспириллами перед каждым событием видообразования, что дало 4, 5 и 6 систем хемотаксиса в A.brasilense Sp245, A. lipoferum 4B и Azospirillum sp. 510 соответственно. Эти пошаговые приобретения сделали последний организм абсолютным «чемпионом по хемотаксису» со 128 генами хемотаксиса, больше, чем любой другой прокариот, секвенированный на сегодняшний день (данные из базы данных MiST [24]). Недавний анализ показал преобладание генов хемотаксиса в ризосфере [25]. Мы определили, что доминантные гены хемотаксиса в этом наборе данных принадлежат к определенному классу хемотаксиса F7 [26] (Рисунок S3 и Таблица S11).Поразительно, что именно эта система F7 является общей для всех Azospirillum и, по прогнозам, была перенесена горизонтально в их общего предка.

    Целлюлолитическая активность может иметь решающее значение для способности некоторых азоспирилл проникать в корни растений [27]. Все геномы Azospirillum кодируют значительное количество гликозилгидролаз, которые необходимы для разложения стенок растительных клеток (рис. 9). Общее количество предполагаемых целлюлаз и гемицеллюлаз в азоспириллах сравнимо с таковым у почвенных целлюлолитических бактерий (Таблица S12), и большинство из них, по прогнозам, приобретаются горизонтально (Таблица S6).Мы протестировали три вида Azospirillum и обнаружили обнаруживаемую целлюлозолитическую активность у A. brasilense Sp245 (рис. 10). Геном A. brasilense Sp245 содержит три фермента, кодируемые AZOBR_p470008, AZOBR_p1110164 и AZOBR_150049 (фиг. 11), которые являются ортологами биохимически подтвержденных целлюлаз. Мы предполагаем, что эти и другие горизонтально переносимые гены (, например, глюкуронатизомераза , которая участвует в разложении пектина) способствовали созданию A.brasilense Sp245 как успешный эндофит [27]. Интересно, что у другой успешной эндофитной бактерии, Herbaspirillum seropedicae , отсутствуют гены, кодирующие ферменты деградации клеточной стенки растений [28], что указывает на то, что эндофиты могут использовать очень разные стратегии для проникновения в растение.

    Рисунок 9. Гликозидгидролазы в Azospirillum с потенциалом разрушения клеточной стенки растений.

    Геномы Azospirillum кодируют от 26 до 34 гликозидгидролаз, которые принадлежат к различным семействам CAZy [54] (Таблица S12).Общее количество гликозидгидролаз у видов Azospirillum аналогично таковому у почвенной целлюлолитической бактерии Thermobifida fusca [61]. Все три вида имеют ортологи предполагаемых целлюлаз (AZOLI_p10561, AZOLI_p40099; AZOBR_p1110164; AZL_a06890; AZL_d05040) с уникальной доменной архитектурой: GH_5 - CalX-β. Две другие предполагаемые целлюлазы (AZOBR_150049, AZOBR_p470008) обнаружены только у A. brasilense . Помимо предполагаемых целлюлаз, виды Azospirillum кодируют предполагаемые внеклеточные эндоглюканазы, которые могут участвовать в деградации целлюлозы / гемицеллюлозы.Например, гликозидгидролазы, принадлежащие к семейству GH8 (AZOLI_p30425, AZL_c05150), которые известны широким спектром целлюлозосодержащих субстратов [62] - [64] и семейству Gh22 (AZOBR_p440082). Предполагается, что все три вида секретируют ряд предполагаемых гемицеллюлаз, которые принадлежат к семействам гликозидгидролаз Gh2 (β-гликозидазы), Gh5 (глюкуронидаза / галактозидаза), Gh20 (эндо-ксиланазы) и Gh26 (лихениназы) (Таблица S12). Семейства CAZy были распределены, как описано в разделе «Материалы и методы».

    https://doi.org/10.1371/journal.pgen.1002430.g009

    Рисунок 10. Целлюлозолитическая активность клеток A. brasilense Sp245.

    Все три вида Azospirillum показаны на левой панели. Известный деструктор целлюлозы ( Dickeya dadantii 3937, T +) и недеградирующий агент ( Agrobacterium tumefaciens NT1, T-) показаны как положительный и отрицательный контроль соответственно.

    https://doi.org/10.1371/journal.pgen.1002430.g010

    Рис. 11. Филогенетические деревья для тиаминсинтетазы (слева) и целлюлазы (справа).

    Деревья иллюстрируют отношения предков и HGT, соответственно, которые были предсказаны с высокой степенью уверенности. Деревья были построены из выровненных последовательностей запроса A. brasilense Sp245 и двадцати наиболее похожих последовательностей, определенных с помощью BLAST. Набор тиаминсинтетазы содержит только представителей альфа-протеобактерий, в том числе Rhodospirillaceae (показано красным).Набор целлюлаз состоит из представителей Actinobacteria, Firmicutes и Chloroflexi с одним представителем альфа-протеобактерий, кроме Azospirillum (которые показаны синим цветом, подчеркивая их происхождение HGT), Azorhizobium .

    https://doi.org/10.1371/journal.pgen.1002430.g011

    Прикрепление, еще одна функция, важная для ассоциации растений Azospirillum , также приобреталось горизонтально. Пили типа IV являются универсальным средством для инициирования и поддержания контакта с растением-хозяином [29], [30].В геноме A. brasilense Sp245 отсутствуют гены, кодирующие пили типа IV, но он кодирует набор генов пилей TAD (плотная адгезия), которые, как известно, предрасположены к HGT [31]. В нашем анализе TAD-пили были уверенно предсказаны как результат HGT (Таблица S6). Мы показываем, что мутант, дефицитный по TAD-пилям, имел серьезный дефект прикрепления и образования биопленок (фиг. 12), предполагая роль TAD в ассоциации растений и микробов.

    Рис. 12. Пили TAD в A. brasilense необходимы для образования биопленки.

    Количественная оценка биопленки, образованной диким типом (wt) и мутантом пилей ( cpaB ) на стекле, с использованием окрашивания кристаллическим фиолетовым (левая панель) и трехмерной реконструкции биопленки, образованной диким типом (вверху) и пилями мутант (внизу) с помощью конфокальной микроскопии (правая панель).

    https://doi.org/10.1371/journal.pgen.1002430.g012

    Заключительные замечания

    Горизонтальный перенос генов долгое время считался основной эволюционной силой прокариот [12].Его роль в появлении новых патогенов и адаптации к изменениям окружающей среды хорошо документирована [32]. В то время как другие недавние исследования показывают, что уровни HGT в естественной среде могут достигать 20% бактериального генома [33], наши данные предполагают, что HGT затронул почти 50% геномов Azospirillum , в тесной связи с резкими изменениями в образ жизни, необходимый для перехода от водной среды к наземной и связи с растениями. Появление этих глобально распространенных связанных с растениями бактерий, которые, по-видимому, совпадают с радиацией наземных растений и развитием корней, вероятно, резко изменило почвенную экосистему.

    Материалы и методы

    Секвенирование и сборка генома

    Геном Azospirillum lipoferum 4B был секвенирован методом полной случайной дроби со смесью 12-кратного охвата чтений Сэнгера, полученных из трех разных библиотек, и 18-кратного охвата 454 прочтений. Две библиотеки плазмид размером 3 т.п.н. (А) и 10 т.п.н. (В), полученные механическим сдвигом с помощью устройства Hydroshear (GeneMachines, Сан-Карлос, Калифорния, США), были сконструированы в Genoscope (Эври, Франция) в pcDNA2.1 (Invitrogen) и в домашний вектор pCNS (модифицированный pSU18, Bartolome et al. [34]), соответственно. Большие вставки (40 т.п.н.) (C) были введены в сайт PmlI pCC1FOS. Секвенирование с использованием векторных праймеров выполняли с использованием секвенатора ABI 3730 Applera. Всего 95904 (A), 35520 (B) и 15360 (C) считываний были проанализированы и собраны с 504591 прочтениями, полученными с помощью Genome Sequencer FLX (Roche Applied Science). Для сборки использовалась версия Arachne «HybridAssemble» (Институт Броуда, Массачусетс), объединяющая 454 контига с чтениями Сэнгера.Для проверки сборки использовался интерфейс Mekano (Genoscope), основанный на визуализации ссылок клонов внутри и между контигами, для проверки покрытия клонами и неправильной сборки. Кроме того, консенсус был подтвержден с использованием функций Consed (www.phrap.org), в частности, по качеству консенсуса и высоким качественным расхождениям. Завершающий этап был достигнут с помощью ПЦР, прогонов праймеров и библиотек транспозонных бомб, и в общей сложности для закрытия пробелов и оценки качества потребовалось 5460 последовательностей (58, 602 и 4800 соответственно).

    Геном штамма Azospirillum brasilense Sp245 был секвенирован методом полной случайной дроби со смесью ~ 10-кратного охвата чтений Сэнгера, полученных из трех разных библиотек, и ~ 25-кратного охвата 454 прочтений. Плазмидную библиотеку размером 3 т.п.н., полученную механическим сдвигом с помощью устройства Hydroshear (GeneMachines, Сан-Карлос, Калифорния, США), сконструировали в лаборатории картирования генома растений (Университет Джорджии, США) в вектор pcDNA2.1 (Invitrogen). Большие вставки (40 т.п.н.) были введены в сайт PmlI pCC1FOS.Секвенирование с использованием векторных праймеров выполняли с использованием секвенатора ABI 3730 Applera. Для сборки использовалась версия Arachne «HybridAssemble», объединяющая 454 контига с чтениями Сангера. Каркасы контигов были созданы с использованием секвенсора (генные коды) и проверены с использованием связи клонов внутри контигов и между ними.

    Аннотации генома

    Программное обеспечение

    AMIGene [35] использовалось для прогнозирования кодирующих последовательностей (CDS), которые подвергались автоматической функциональной аннотации [36]. В результате получается 6233 А.lipoferum 4B CDS и 7848 A. brasilense Sp245 CDS были присвоены уникальные идентификаторы с префиксом «AZOLI» или «AZOBR» в соответствии с их соответствующими геномами. Предполагаемые ортологи и группы синтении были рассчитаны между секвенированными геномами и 650 другими полными геномами, загруженными из базы данных RefSeq (NCBI), с использованием процедуры, описанной в Vallenet et al. [36]. Ручная проверка автоматической аннотации была выполнена с использованием интерфейса MaGe (Magnifying Genomes). Искатель IS (www-is.biotoul.fr) использовался для аннотирования последовательностей вставок [37]. Нуклеотидная последовательность A. lipoferum 4B и данные аннотации депонированы в банк данных EMBL под номерами доступа: FQ311868 (хромосома), FQ311869 (p1), FQ311870 (p2), FQ311871 (p3), FQ311872 (p4118). ), FQ311874 (стр. 6). Нуклеотидная последовательность A. brasilense Sp245 и данные аннотации депонированы в банке данных EMBL под номерами доступа: HE577327 (хромосома), HE577328 (p1), HE577329 (p2), HE577330 (p3), HE577331 (p432), p5773 ), HE577333 (стр. 6).Кроме того, все данные (т. Е. Синтаксические и функциональные аннотации и результаты сравнительного анализа) хранились в реляционной базе данных под названием AzospirilluScope [36], которая общедоступна по адресу http://www.genoscope.cns.fr/ agc / mage / microscope / about / collabprojects.php? P_id = 39.

    Вычислительная геномика / биоинформатика

    поисков BLAST было выполнено с использованием инструментария NCBI версии 2.2.24+ [38]. Множественные выравнивания последовательностей были построены с использованием алгоритма L-INS-i MAFFT [39] с параметрами по умолчанию.Построение филогенетического дерева выполнялось с использованием PhyML [40] с параметрами по умолчанию, если не указано иное. Последовательности 16S рРНК были получены из проекта Ribosomal Database Project [41].

    Конкатенированное дерево рибосомных белков было построено из секвенированных членов альфа-протеобактерий с 98% отсечкой идентичности последовательности 16S рРНК для ограничения избыточного представления. Были использованы следующие рибосомные белки: L3, L5, L11, L13, L14, S3, S7, S9, S11 и S17. Белки были идентифицированы с использованием соответствующих моделей Pfam и поисков HMMER [42] против геномов секвенированных альфа-протеобактерий, выбранных выше.Последовательности были выровнены и объединены. GBlocks [43] с параметрами по умолчанию использовались для уменьшения количества столбцов с низкой информацией. Дерево было построено с использованием PhyML со следующими параметрами: эмпирические частоты аминокислот, 4 категории замен, расчетный параметр гамма-распределения и поиск топологии дерева NNI.

    Присвоение родословной гена

    запросов последовательностей белков из всех 3 геномов Azospirillum были использованы в поисках BLAST против неизбыточного набора геномов микробов, созданного Wuichet и Zhulin [26], дополненного секвенированными членами Rhodospirillales , отсутствующими в исходном наборе ( Acetobacter pasteurianus IFO 3283-01, alpha proteobacterium BAL199, Magnetospirillum gryphiswaldense MSR-1 и Magnetospirillum magnetotacticum MS-1).Использовалось отсечение E-value 10∧ −4.

    При определении происхождения использовалось только первое появление каждого вида. Белки были отнесены к наследственным или горизонтально переносимым с разной степенью достоверности на основании присутствия представителей Rhodospirillales и Rhodospirillaceae в первых восьми совпадениях BLAST. Отнесение к предкам было основано на 8 лучших совпадениях на основе количества геномов Rhodospirillaceae в базе данных: 2 Azospirillum , 3 Magnetospirillum , 2 Rhodospirillum и Nisaea sp.BAL199, за исключением организма, для которого выполняется определение происхождения. У предковых белков с высокой степенью достоверности есть по крайней мере 6 из 8 основных видов, принадлежащих к Rhodospirillales , или все, кроме 1, если результат BLAST имел менее 8 видов. Это правило допускает 1-2 независимых события HGT от Rhodospirillales до других отдаленно родственных видов. У предковых белков со средней степенью достоверности не менее 4 Rhodospirillaceae в топ-8. У предковых белков с низкой достоверностью не менее 1 Rhodospirillaceae в топ-8, за исключением попаданий в другие геномы Azospirillum .Горизонтально переносимые белки с высокой степенью достоверности имеют 0 совпадений с Rhodospirillales в первой 10, за исключением совпадений с другими геномами Azospirillum . Горизонтально перенесенные белки со средней степенью достоверности имеют 0 совпадений с Rhodospirillales в топ-5, исключая совпадения с другими геномами Azospirillum . Горизонтально переносимые белки с низкой степенью достоверности имеют 0 совпадений с Rhodospirillaceae в топ-8, исключая совпадения с другими геномами Azospirillum .Неназначенные белки либо не имеют совпадений BLAST за пределами Azospirillum , либо одновременно классифицируются как горизонтально переносимые со средней степенью достоверности и предковые со средней или низкой степенью достоверности.

    Протеомика

    Рост клеток.

    Штамм Azospirillum brasilense Sp245: Ночные заквасочные культуры (5 мл) инокулировали из свежих чашек. Заквасочные культуры выращивали в течение ночи при 27 ° C на водяной бане со встряхиванием в минимальной среде, содержащей малат в качестве источника углерода и хлорид аммония в качестве источника азота.Клетки осаждали из заквасочных культур и промывали подходящей питательной средой. Базовая среда для всех культур была минимальной средой (MMAB) [44] с 20 мМ малатом в качестве источника углерода, хлоридом аммония в качестве источника азота, где это необходимо, и молибдатом. Заквасочные культуры ресуспендировали в подходящей среде и использовали для инокуляции 250 мл культур для азотфиксирующего роста или 500 мл культур для не азотфиксирующего роста. Для фиксации азота требуется много энергии и постоянная оптимальная концентрация кислорода, поэтому рост азотфиксирующих клеток происходит медленнее, чем тех, которые растут в условиях достаточного количества азота.Клетки, выращенные в условиях связывания азота, демонстрируют время удвоения 170 минут, в то время как контрольные (не связывающие азот) клетки имеют время удвоения 120 минут [21]. Кроме того, OD клеток, выращенных в азотфиксирующих культурах, никогда не достигает высоких уровней, имеет тенденцию выравниваться на уровне или ниже OD600, равном 0,2–0,3 [21]. Поэтому каждое условие роста было оптимизировано следующим образом. Для азотфиксирующих культур газообразный азот барботировали через верхнее пространство флакона со средой через порт для сыворотки и вводили достаточно воздуха, чтобы получить конечное содержание кислорода в верхнем пространстве 2%; культуры выращивали при 25 ° C без встряхивания до ранней логарифмической фазы (OD 600 = 0.1–0.2), чтобы свести к минимуму воздействие высоких уровней кислорода, поскольку виды Azospirillum являются микроаэрофильными диазотрофами. Нефиксирующие азот культуры выращивали в оптимальных условиях роста (встряхивание и в присутствии аммония) при 25 ° C на орбитальном шейкере до средней логарифмической фазы (OD 600 = 0,5–0,6). Клетки собирали центрифугированием при 8000 об / мин в течение 10 минут, дважды промывали 50 мМ Трис (pH 7,9), затем осаждали центрифугированием при 8000 об / мин в течение 10 минут и хранили при -80 C. Осадки клеток из двух биологических повторов объединяли в течение последующий препарат протеома. Azospirillum lipoferum : Условия роста были такими, как описано выше для A. brasilense Sp245, за исключением того, что клетки выращивали в среде MMAB с добавлением 1 мг / л D-биотина.

    Препарат протеома для ЖХ / ЖХ-МС / МС.

    Осадки замороженных клеток (0,1 г для каждого образца) ресуспендировали со скоростью 500 мкл буфера для лизиса / 0,1 г массы влажного осадка клеток в буфере для лизиса 6 M гидрохлорида гуанидина, 10 мМ DTT, солюбилизированного в 50 мМ Tris-HCl, 10 мМ CaCl 2 [45].Затем ресуспендированные клетки подвергали дальнейшему лизису ультразвуком. Лизат центрифугировали при 18000 g в течение 20 минут для очистки клеточного дебриса. Супернатант собирали для триптического расщепления. Добавляли 10 мМ DTT и инкубировали лизат при 60 ° C в течение 1 часа. Затем лизат разводили в 6 раз буфером для расщепления трипсина (50 мМ Tris-HCl, 10 мМ CaCl 2 , 10 мМ DTT, pH 7,9) и 20 мкг трипсина для секвенирования (Promega, Madison, WI) добавляли к каждому. образец. Образцы инкубировали в течение ночи при 37 ° C с осторожным вращением.На следующее утро добавляли дополнительные 20 мкг трипсина, а затем образцы инкубировали еще 5–6 часов при 37 ° C с осторожным вращением. Переваривание останавливали добавлением 5 мкл муравьиной кислоты к 5 мл лизата. Затем образцы обессоливали с использованием твердофазной экстракции Sep-Pak Plus C-18 (Waters, Milford, MA) в соответствии с рекомендациями производителя, а затем концентрировали и заменяли растворитель на 100% -ную Н 2 O, пригодную для ВЭЖХ, 0,1% муравьиной кислоты с использованием вакуумное центрифугирование (Savant, Thermo Scientific).Образцы разделяли на аликвоты по 40 мкл и хранили при -80 ° C до анализа.

    Анализ ЖХ / ЖХ-МС / МС.

    Пробы протеома анализировали с помощью технологии многомерной идентификации белков (MudPIT) [46] - [48] с трехфазными колонками. Колонки были индивидуально упакованы с использованием ячейки давления (New Objective, Woburn, MA). Задние колонки загружали в капиллярную трубку из плавленого кварца с внутренним диаметром 150 мкм, сначала 3 см смолы с сильным катионообменом (SCX) Luna диаметром 5 мкм (Phenomenex, Torrance, CA), а затем 3 см смолы с обращенной фазой Aqua 5 мкм C-18. (Феноменекс).Аликвоты протеома (40 мкл) загружали непосредственно на заднюю колонку через ячейку под давлением и затем связывали с передней колонкой. Передние колонки вытягивали из капиллярной трубки из плавленого кварца с внутренним диаметром 100 мкм до наконечника с внутренним диаметром 5 мкм с помощью лазерного съемника P-2000 (Sutter Instruments, Новато, Калифорния) и набивали слоем Aqua 5 мкм длиной 17 см. смола с обращенной фазой диаметром C-18. Эта колонка действует как разделяющая колонка для пептидов, элюированных из задней колонки. Для анализа объединенные колонки помещали непосредственно в линию с масс-спектрометром LTQ (ThermoScaught, Сан-Хосе, Калифорния) с использованием источника Proxeon.

    Хроматографическое разделение было выполнено с помощью системы Ultimate HPLC (LC Packings, подразделение Dionex, Сан-Франциско, Калифорния), обеспечивающей скорость потока 100 мкл / мин, которая была разделена перед разделительной колонкой, так что конечная скорость потока через разделительную колонку колонка ∼300 нл / мин. Было выполнено двенадцать стадий двумерной (2D) хроматографии. Первоначальный 1-часовой градиент от буфера A (95% воды, 5% ацетонитрила, 0,1% муравьиной кислоты) до буфера B (70% ацетонитрил, 0,1% муравьиной кислоты) переносил пептиды из исходной колонки с обращенной фазой на колонку с сильным катионообменом. .Последующие циклы включали 2-минутные импульсы соли с различным процентным содержанием 500 мМ ацетата аммония (10, 15, 20, 25, 30, 35, 40, 45, 50, 60%) для первой элюции подмножеств пептидов из колонки SCX в соответствии с зарядом. с последующим 2-часовым градиентом от буфера A к буферу B для дальнейшего разделения пептидов по гидрофобности. Заключительный хроматографический этап состоял из 20-минутного импульса соли 100% 500 мМ ацетата аммония с последующим 2-часовым градиентом от A к B.

    Сбор данных контролировался программным обеспечением Xcaliber (ThermoScientific).Данные были собраны в зависимом от данных режиме с одним полным сканированием, за которым следовали 6 зависимых сканирований, каждое с 2 микросканированиями. Динамическое исключение использовалось с числом повторений 1, продолжительностью повторения 60 с, размером списка исключения 300 и продолжительностью 180 с. Ширина изоляционной массы была установлена ​​равной 3 единицам m / z.

    Анализ данных.

    База данных белков Sp245 была создана из транслированных CDS, названных в черновом варианте последовательности генома (http://genome.ornl.gov/microbial/abra/19sep08/). База данных белков 4B была построена из транслированных CDS, называемых полной последовательностью генома.Список общих загрязняющих веществ был добавлен к последовательностям вызова генов, и все кодирующие последовательности, включая загрязняющие последовательности, были обращены и добавлены к прямым последовательностям, чтобы служить в качестве отвлекающих факторов. По количеству идентификаций в обратном направлении определяли частоту ложноположительных (FP) пептидов по формуле% FP = 2 [№ обратный идентификатор / (номер обратного идентификатора + номер реального идентификатора)] [49]; Ставки FP варьировались от 1,4% до 4,3%. Все спектры МС / МС сравнивали с соответствующей базой данных с использованием SEQUEST [50], указав триптическое расщепление, толерантность пептида к массе 3 m / z и толерантность к ионам фрагментов 0.5 м / з. Кроме того, параметры поиска включали две динамические модификации: 1. метилирование, представленное массовым сдвигом на +14 m / z на остатках глутамата, и 2. дезамидирование с последующим метилированием, представленное массовым сдвигом на +15 m / z на остатках глутамина. Файлы выходных данных были отсортированы и отфильтрованы с помощью DTASelect [51], указав уровни фильтра XCorr 1,8 для пептидов с состоянием заряда +1, 2,5 для пептидов с состоянием заряда +2 и 3,5 для состояния заряда +3, минимальная дельта CN 0,08 , полупотриптический статус и 2 пептида на идентификацию белка.Чтобы определить относительное содержание данного белка в образце, нормированные коэффициенты спектрального содержания (NSAF) были рассчитаны для каждого отдельного белка k по формуле NSAF k = (SpC / L) k / Σ (SpC / L ) n , где SpC - общее спектральное количество всех пептидов, вносящих вклад в белок k, L - длина белка k, а n - общее количество белков, обнаруженных в образце [52].

    Идентификация гликозидгидролаз

    Двунаправленный BLAST был использован для идентификации ортологов предполагаемых генов гликозидгидролазы (GH).Пакет Phyml использовался для подтверждения эволюционных взаимосвязей и визуализации результатов. Архитектура доменов была получена с помощью поиска Pfam [53] для каждого белка. Затем информация из CAZy [54] и недавнего анализа [55] была использована для определения предполагаемой активности предсказанных GH.

    Классификация систем хемотаксиса в ризосфере

    Белки хемотаксиса были идентифицированы в наборах геномных данных, как описано ранее [56]. Используя последовательности CheA из недавнего анализа классификации системы хемотаксиса [26], выравнивание областей P3 – P5 CheA было построено для каждого класса и для всего набора последовательностей CheA.Каждое выравнивание делали неизбыточным, так что ни одна пара последовательностей не имела более 80% идентичности последовательностей. Скрытые марковские модели (HMM) были построены из каждого неизбыточного выравнивания и использовались для создания библиотеки с помощью программного пакета HMMER3 (версия HMMER 3.0b3) [42] и параметров по умолчанию.

    Последовательности ризосферы CheA из недавнего исследования [25] сравнивали с библиотекой CheA HMM. Неклассифицированные последовательности (Unc) - это те, которые имеют наибольшее совпадение с полным набором CheA HMM, а не с HMM для конкретного класса.Остальные последовательности были отнесены к классу HMM, набравшему наибольшее количество баллов.

    Анализ целлюлазы

    Штаммы Azospirillum и контрольные штаммы ( Dickeya dadantii 3937 в качестве положительного контроля, A. tumefaciens NT1 в качестве отрицательного контроля) культивировали в течение 16 ч в жидкой минимальной среде AB [57], содержащей 0,2% малата и 1 мг. / Л биотина. Аликвоту из 10 7 клеток (для Dickeya dadantii 3937) или 2,10 7 клеток (для всех других штаммов) помещали на чашки AB, содержащие 0.1% карбоксиметилцеллюлозы вместо малата. Планшеты инкубировали в течение 5 дней перед окрашиванием, как описано ранее [58].

    Анализ мутанта пили и прикрепления

    Внутренний фрагмент cpaB (AZOBR_p460079) длиной 211 п.н. амплифицировали с помощью ПЦР с праймерами F6678 (GCGTGACCTGATCCTGAC) и F6679 (GTGACCGTCTCGCTCTGAC) и субклонировали в pGEM-T easy (Promega). Белые колонии подвергали скринингу с помощью ПЦР с праймерами F6678 и F6679 для правильной вставки в pGEM-T easy, что приводило к pR3.37. Вставка плазмиды pR3.37 была расщеплена Not I и клонирована в сайт Not I pKNOCK-Km [59], что привело к pR3.39 после переноса в химически компетентные клетки E. coli. S17.1 λ пир . pR3.39 была введена в A. brasilense Sp245 путем спаривания у двух родителей. Трансконъюганты, полученные в результате одного события рекомбинации pR3.39, отбирали на среде AB, содержащей 0,2% малат, ампициллин (100 мг / мл) и канамицин (40 мг / мл).Правильная вставка pKNOCK в cpaB была подтверждена ПЦР с праймерами (F6678 и F5595 TGTCCAGATAGCCCAGTAGC, расположенный на pKNOCK) и секвенированием ампликона ПЦР.

    Sp245 и Sp245 cpaB были помечены pMP2444 [60], что обеспечивает конститутивную экспрессию EGFP. Штаммы выращивали в NFB * (безазотный бульон, содержащий 0,025% LB) с соответствующими антибиотиками в стеклянных пробирках, содержащих покровное стекло, при умеренном боковом встряхивании в течение 6 дней. После инкубации жидкость и покровное стекло были удалены из пробирок, а биопленка, образовавшаяся на границе раздела воздух / жидкость, была окрашена на 0.1% кристаллический фиолетовый. После двух промывок дистиллированной водой кристаллический фиолетовый растворяли в этаноле и количественно определяли спектрофотометрией при 570 нм. Эксперимент проводили дважды в трех экземплярах. Параллельно колонизацию покровного стекла контролировали с помощью конфокальной лазерной сканирующей микроскопии (микроскоп 510 Meta; Carl Zeiss SAS), оснащенной аргон-криптоновым лазером, детекторами и наборами фильтров для зеленой флуоресценции (т. Е. 488 нм для возбуждения). и от 510 до 531 нм для обнаружения). Были взяты серии горизонтальных ( x-y ) оптических срезов толщиной 1 мкм по всей длине биопленок Sp245 и Sp245 cpaB .Трехмерные реконструкции биопленок были выполнены с использованием программного обеспечения LSM версии 3.5 (Carl Zeiss S.A.S.).

    Дополнительная информация

    Рисунок S1.

    Хромосомы, хромиды и плазмиды в геномах Azospirillum . Схематическое изображение хромосом, хромид и плазмид A. lipoferum 4B (от A до G) и A. brasilense Sp245 (от H до N). Радиусы не в масштабе. Два внешних кольца (1 и 2) представляют гены на прямой и обратной цепях, соответственно, окрашенные в функциональные категории COG: красный цвет, хранение и обработка информации; синий, сотовые процессы и сигнализация; зеленый - метаболизм; фиолетовый, плохо охарактеризованный; серый, COG не обнаружено.Следующее кольцо (3): гены тРНК (синий) и рРНК (красный). Кольцо 4 показывает принадлежность к ортологии для всех предсказанных белков: красный = присутствует во всех 3 штаммах Azospirillum (4B, Sp245, B510), оранжевый = присутствует в 4B и Sp245, фиолетовый = присутствует в 4B и B510, зеленый = присутствует в Sp245 и B510, синий = уникальный для штамма. Кольцо 5 показывает принадлежность к родословной для всех предсказанных белков: красный = наследственный, синий = горизонтально перенесенный (интенсивность цвета указывает на высокий (темный), средний (средний) и низкий (светлый) уровни достоверности для прогноза), серый = неназначенный.Кольцо 6 представляет перекос G / C (зеленый = повышенное содержание на прямой нити; фиолетовый = повышенное содержание на обратной нити), а кольцо 7 представляет содержание GC.

    https://doi.org/10.1371/journal.pgen.1002430.s001

    (PDF)

    Рисунок S2.

    Опероны хемотаксиса в Azospirillum . Системы хемотаксиса классов F5, F9 и ACF присутствовали у общего предка азоспирилл и других Rhodospirillaceae (например, Rhodospirillum centenum ) [65], [66].Система F7 была горизонтально передана общему предку Azospirillum . Система F8 была горизонтально передана общему предку Azospirillum lipoferum . Неклассифицированная система хемотаксиса (Unc) была получена горизонтально с помощью Azospirillum sp. Только B510. См. Таблицы S6 и S10 для получения подробной информации по каждой системе. Классы хемотаксиса были назначены в соответствии с предыдущей работой Wuichet & Zhulin [26].

    https://doi.org/10.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *